ID: 984013013

View in Genome Browser
Species Human (GRCh38)
Location 4:174392977-174392999
Sequence ATAATCCAGCAATCCCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984013013_984013014 6 Left 984013013 4:174392977-174392999 CCAAAGTGGGATTGCTGGATTAT No data
Right 984013014 4:174393006-174393028 ATTCTTTTTATAGTTTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984013013 Original CRISPR ATAATCCAGCAATCCCACTT TGG (reversed) Intergenic
No off target data available for this crispr