ID: 984018280

View in Genome Browser
Species Human (GRCh38)
Location 4:174452319-174452341
Sequence ATTACTTGGTACTGAAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984018275_984018280 13 Left 984018275 4:174452283-174452305 CCTTGAGCAAACTTTTAAAGGTC No data
Right 984018280 4:174452319-174452341 ATTACTTGGTACTGAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984018280 Original CRISPR ATTACTTGGTACTGAAACTC TGG Intergenic
No off target data available for this crispr