ID: 984019113

View in Genome Browser
Species Human (GRCh38)
Location 4:174463233-174463255
Sequence TTGCCACAAGGGCCCTCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984019108_984019113 -9 Left 984019108 4:174463219-174463241 CCTCATTTGGTCCTTTGCCACAA No data
Right 984019113 4:174463233-174463255 TTGCCACAAGGGCCCTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984019113 Original CRISPR TTGCCACAAGGGCCCTCTTA GGG Intergenic
No off target data available for this crispr