ID: 984021505

View in Genome Browser
Species Human (GRCh38)
Location 4:174489198-174489220
Sequence TGGATAGGATATGATAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984021505_984021509 20 Left 984021505 4:174489198-174489220 CCTCTTTTATCATATCCTATCCA No data
Right 984021509 4:174489241-174489263 CACTTTGAAAACATGGATCTAGG No data
984021505_984021508 13 Left 984021505 4:174489198-174489220 CCTCTTTTATCATATCCTATCCA No data
Right 984021508 4:174489234-174489256 TTTCACACACTTTGAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984021505 Original CRISPR TGGATAGGATATGATAAAAG AGG (reversed) Intergenic
No off target data available for this crispr