ID: 984021506

View in Genome Browser
Species Human (GRCh38)
Location 4:174489213-174489235
Sequence AAAACTGAATCACTCTGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984021506_984021510 16 Left 984021506 4:174489213-174489235 CCTATCCAGAGTGATTCAGTTTT No data
Right 984021510 4:174489252-174489274 CATGGATCTAGGCATGTTATAGG No data
984021506_984021509 5 Left 984021506 4:174489213-174489235 CCTATCCAGAGTGATTCAGTTTT No data
Right 984021509 4:174489241-174489263 CACTTTGAAAACATGGATCTAGG No data
984021506_984021508 -2 Left 984021506 4:174489213-174489235 CCTATCCAGAGTGATTCAGTTTT No data
Right 984021508 4:174489234-174489256 TTTCACACACTTTGAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984021506 Original CRISPR AAAACTGAATCACTCTGGAT AGG (reversed) Intergenic
No off target data available for this crispr