ID: 984021507

View in Genome Browser
Species Human (GRCh38)
Location 4:174489218-174489240
Sequence TGTGAAAAACTGAATCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984021507_984021509 0 Left 984021507 4:174489218-174489240 CCAGAGTGATTCAGTTTTTCACA No data
Right 984021509 4:174489241-174489263 CACTTTGAAAACATGGATCTAGG No data
984021507_984021508 -7 Left 984021507 4:174489218-174489240 CCAGAGTGATTCAGTTTTTCACA No data
Right 984021508 4:174489234-174489256 TTTCACACACTTTGAAAACATGG No data
984021507_984021510 11 Left 984021507 4:174489218-174489240 CCAGAGTGATTCAGTTTTTCACA No data
Right 984021510 4:174489252-174489274 CATGGATCTAGGCATGTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984021507 Original CRISPR TGTGAAAAACTGAATCACTC TGG (reversed) Intergenic
No off target data available for this crispr