ID: 984021508

View in Genome Browser
Species Human (GRCh38)
Location 4:174489234-174489256
Sequence TTTCACACACTTTGAAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984021504_984021508 26 Left 984021504 4:174489185-174489207 CCATTCATTGTCTCCTCTTTTAT No data
Right 984021508 4:174489234-174489256 TTTCACACACTTTGAAAACATGG No data
984021505_984021508 13 Left 984021505 4:174489198-174489220 CCTCTTTTATCATATCCTATCCA No data
Right 984021508 4:174489234-174489256 TTTCACACACTTTGAAAACATGG No data
984021507_984021508 -7 Left 984021507 4:174489218-174489240 CCAGAGTGATTCAGTTTTTCACA No data
Right 984021508 4:174489234-174489256 TTTCACACACTTTGAAAACATGG No data
984021506_984021508 -2 Left 984021506 4:174489213-174489235 CCTATCCAGAGTGATTCAGTTTT No data
Right 984021508 4:174489234-174489256 TTTCACACACTTTGAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984021508 Original CRISPR TTTCACACACTTTGAAAACA TGG Intergenic
No off target data available for this crispr