ID: 984021509

View in Genome Browser
Species Human (GRCh38)
Location 4:174489241-174489263
Sequence CACTTTGAAAACATGGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984021507_984021509 0 Left 984021507 4:174489218-174489240 CCAGAGTGATTCAGTTTTTCACA No data
Right 984021509 4:174489241-174489263 CACTTTGAAAACATGGATCTAGG No data
984021505_984021509 20 Left 984021505 4:174489198-174489220 CCTCTTTTATCATATCCTATCCA No data
Right 984021509 4:174489241-174489263 CACTTTGAAAACATGGATCTAGG No data
984021506_984021509 5 Left 984021506 4:174489213-174489235 CCTATCCAGAGTGATTCAGTTTT No data
Right 984021509 4:174489241-174489263 CACTTTGAAAACATGGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984021509 Original CRISPR CACTTTGAAAACATGGATCT AGG Intergenic
No off target data available for this crispr