ID: 984022521

View in Genome Browser
Species Human (GRCh38)
Location 4:174503243-174503265
Sequence GCTCCCATACTCATGGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984022514_984022521 17 Left 984022514 4:174503203-174503225 CCATTTGGGAGAACTTTGCCAGC 0: 1
1: 0
2: 1
3: 8
4: 124
Right 984022521 4:174503243-174503265 GCTCCCATACTCATGGCAGTTGG No data
984022518_984022521 -1 Left 984022518 4:174503221-174503243 CCAGCACTAAGCAGGAAGGGTGG 0: 1
1: 0
2: 1
3: 18
4: 142
Right 984022521 4:174503243-174503265 GCTCCCATACTCATGGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984022521 Original CRISPR GCTCCCATACTCATGGCAGT TGG Intronic
No off target data available for this crispr