ID: 984022521 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:174503243-174503265 |
| Sequence | GCTCCCATACTCATGGCAGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 984022514_984022521 | 17 | Left | 984022514 | 4:174503203-174503225 | CCATTTGGGAGAACTTTGCCAGC | 0: 1 1: 0 2: 1 3: 8 4: 124 |
||
| Right | 984022521 | 4:174503243-174503265 | GCTCCCATACTCATGGCAGTTGG | No data | ||||
| 984022518_984022521 | -1 | Left | 984022518 | 4:174503221-174503243 | CCAGCACTAAGCAGGAAGGGTGG | 0: 1 1: 0 2: 1 3: 18 4: 142 |
||
| Right | 984022521 | 4:174503243-174503265 | GCTCCCATACTCATGGCAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 984022521 | Original CRISPR | GCTCCCATACTCATGGCAGT TGG | Intronic | ||
| No off target data available for this crispr | |||||