ID: 984024068

View in Genome Browser
Species Human (GRCh38)
Location 4:174522279-174522301
Sequence CGCCGCCCGAGGTGCACTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 59}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984024068_984024081 29 Left 984024068 4:174522279-174522301 CCGCCAGTGCACCTCGGGCGGCG 0: 1
1: 0
2: 1
3: 17
4: 59
Right 984024081 4:174522331-174522353 AATTTCCGCGGCTGGGCGCCGGG 0: 1
1: 0
2: 1
3: 3
4: 43
984024068_984024079 22 Left 984024068 4:174522279-174522301 CCGCCAGTGCACCTCGGGCGGCG 0: 1
1: 0
2: 1
3: 17
4: 59
Right 984024079 4:174522324-174522346 GCAGAGAAATTTCCGCGGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 50
984024068_984024074 -10 Left 984024068 4:174522279-174522301 CCGCCAGTGCACCTCGGGCGGCG 0: 1
1: 0
2: 1
3: 17
4: 59
Right 984024074 4:174522292-174522314 TCGGGCGGCGGGGCGAGTCTCGG 0: 1
1: 0
2: 0
3: 5
4: 89
984024068_984024080 28 Left 984024068 4:174522279-174522301 CCGCCAGTGCACCTCGGGCGGCG 0: 1
1: 0
2: 1
3: 17
4: 59
Right 984024080 4:174522330-174522352 AAATTTCCGCGGCTGGGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 34
984024068_984024076 0 Left 984024068 4:174522279-174522301 CCGCCAGTGCACCTCGGGCGGCG 0: 1
1: 0
2: 1
3: 17
4: 59
Right 984024076 4:174522302-174522324 GGGCGAGTCTCGGAGTGTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 103
984024068_984024078 21 Left 984024068 4:174522279-174522301 CCGCCAGTGCACCTCGGGCGGCG 0: 1
1: 0
2: 1
3: 17
4: 59
Right 984024078 4:174522323-174522345 GGCAGAGAAATTTCCGCGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 55
984024068_984024077 17 Left 984024068 4:174522279-174522301 CCGCCAGTGCACCTCGGGCGGCG 0: 1
1: 0
2: 1
3: 17
4: 59
Right 984024077 4:174522319-174522341 TGTGGGCAGAGAAATTTCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 155
984024068_984024075 -1 Left 984024068 4:174522279-174522301 CCGCCAGTGCACCTCGGGCGGCG 0: 1
1: 0
2: 1
3: 17
4: 59
Right 984024075 4:174522301-174522323 GGGGCGAGTCTCGGAGTGTGTGG 0: 1
1: 0
2: 1
3: 5
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984024068 Original CRISPR CGCCGCCCGAGGTGCACTGG CGG (reversed) Intronic