ID: 984024144

View in Genome Browser
Species Human (GRCh38)
Location 4:174522621-174522643
Sequence CACCTGCCCCCTGAGCGTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984024140_984024144 1 Left 984024140 4:174522597-174522619 CCGCCGGGGAACCCACGACTGTG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 984024144 4:174522621-174522643 CACCTGCCCCCTGAGCGTTCTGG 0: 1
1: 0
2: 1
3: 11
4: 131
984024141_984024144 -2 Left 984024141 4:174522600-174522622 CCGGGGAACCCACGACTGTGTCA 0: 1
1: 0
2: 6
3: 18
4: 166
Right 984024144 4:174522621-174522643 CACCTGCCCCCTGAGCGTTCTGG 0: 1
1: 0
2: 1
3: 11
4: 131
984024138_984024144 8 Left 984024138 4:174522590-174522612 CCAGCGCCCGCCGGGGAACCCAC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 984024144 4:174522621-174522643 CACCTGCCCCCTGAGCGTTCTGG 0: 1
1: 0
2: 1
3: 11
4: 131
984024142_984024144 -10 Left 984024142 4:174522608-174522630 CCCACGACTGTGTCACCTGCCCC 0: 1
1: 0
2: 1
3: 13
4: 127
Right 984024144 4:174522621-174522643 CACCTGCCCCCTGAGCGTTCTGG 0: 1
1: 0
2: 1
3: 11
4: 131
984024139_984024144 2 Left 984024139 4:174522596-174522618 CCCGCCGGGGAACCCACGACTGT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 984024144 4:174522621-174522643 CACCTGCCCCCTGAGCGTTCTGG 0: 1
1: 0
2: 1
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984024144 Original CRISPR CACCTGCCCCCTGAGCGTTC TGG Exonic
900292376 1:1928987-1929009 CACCTCCCCCTTGAGATTTCAGG + Intronic
900479606 1:2891691-2891713 CTGCTGCCCCCTGACCCTTCCGG - Intergenic
900590546 1:3457565-3457587 CTCCTGCCCCCTTATCCTTCCGG - Intronic
902614514 1:17616477-17616499 CTCCTGCCCCCTGCGCTGTCTGG + Intronic
902696813 1:18145761-18145783 CACCTGCCGGCTGAGCGTGGAGG + Intronic
903015293 1:20357806-20357828 GGCCAGCCCCCTGAGCTTTCAGG + Intergenic
907974125 1:59414510-59414532 CAGGTGCCCCCAGAGGGTTCTGG - Intronic
910263266 1:85312259-85312281 CCTCTGTCCCCTGAGAGTTCGGG + Intergenic
913452462 1:119001380-119001402 CCCCTGCCCCCTCAGCCTGCGGG - Intergenic
914267031 1:146046916-146046938 CTCCTGACCCCTGAGAATTCTGG - Intergenic
915311832 1:155008965-155008987 CGCCAGGCCCCTCAGCGTTCAGG + Intronic
921543861 1:216450979-216451001 CACCTTGCCCCTGAGCTTTTGGG + Intergenic
1063072022 10:2676197-2676219 GACCTTGCCCCTGTGCGTTCAGG - Intergenic
1063391182 10:5650770-5650792 CACCTGCTCCCTGAGCCTGCAGG + Intronic
1067069956 10:43124112-43124134 CACGTGCCCCCTGGGCCATCTGG - Intronic
1069776674 10:70931359-70931381 CACCTGCCTCCTGAGCTGCCGGG + Intergenic
1070164513 10:73887722-73887744 CCCCTGCCCCTTGGGCTTTCTGG - Intergenic
1072170754 10:92859200-92859222 AACCTGCCCCATGAGTGTTATGG - Intronic
1075326522 10:121536650-121536672 CACCTCCCCTTTGAGCTTTCTGG - Intronic
1075792310 10:125093751-125093773 GTGCTGCCCCCTGAGCGTCCTGG - Intronic
1076350640 10:129812809-129812831 CAAGTGCCCCCAGAGCTTTCTGG + Intergenic
1076578297 10:131487670-131487692 CACCTGCCATCTGAGCCTGCTGG - Intergenic
1076856403 10:133117446-133117468 GACCTGCCCCCTGGGAGGTCCGG + Intronic
1077181407 11:1218828-1218850 CACCTTCCACCTGGGCGTCCCGG - Intergenic
1077405445 11:2380520-2380542 CACCTGCGCCCTGACCGCTTTGG + Intronic
1078147949 11:8734986-8735008 CCCCTGCCCCGACAGCGTTCAGG - Intronic
1079102798 11:17552133-17552155 CACCTGCCCTCTGCCCTTTCAGG - Intronic
1084040949 11:66542470-66542492 CACCTGCTCCATGAGCCTGCAGG - Intronic
1084112004 11:67020294-67020316 CTCCTGCCTCCTGGGCCTTCTGG - Intronic
1084117364 11:67050074-67050096 CCCCTGCCCCCACAGCGATCAGG - Exonic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1084409390 11:68997583-68997605 CACCTGCCCTGTGAGGGTGCTGG + Intergenic
1085394639 11:76201112-76201134 CACCTTCTCCCTGAGCCTTCTGG - Intronic
1089647646 11:119890650-119890672 CAGCTGCGCACTGAGTGTTCAGG - Intergenic
1091109634 11:132953760-132953782 GACCTGCCCCCTGAGAGCTGGGG + Intronic
1094089461 12:26631967-26631989 CATCTTCCCCATGAGCGTGCCGG - Exonic
1095968053 12:47882693-47882715 TACCTGCCCCCTGCTCCTTCAGG - Exonic
1096523158 12:52195395-52195417 CACCTGCCCACTCAGAGTCCTGG + Intergenic
1098633595 12:72754337-72754359 CACGTCCCCCCTGAGCTTTGAGG - Intergenic
1101773712 12:107775269-107775291 CACCGCGCCCCTGGGCGTTCCGG + Exonic
1102827489 12:115961673-115961695 CACCTGGCCCCTAAGTGTTTGGG - Intronic
1102963191 12:117107011-117107033 CATCTGCCCCCTGCAAGTTCCGG - Intergenic
1104072302 12:125356437-125356459 CACCTTCCTCCTGGGTGTTCAGG + Intronic
1106172050 13:27296703-27296725 CTCCTGCTCCCTGAGCAATCTGG + Intergenic
1106182990 13:27384103-27384125 CACATGCCCACTGAGGCTTCAGG + Intergenic
1109927787 13:69168533-69168555 CACATGCCCTCTGAGGCTTCGGG + Intergenic
1111198014 13:84898620-84898642 CACATGCCCACTGGGGGTTCAGG - Intergenic
1114483224 14:23047971-23047993 CCCCGGCCCCCTGAGCGCCCGGG - Exonic
1121003082 14:90465940-90465962 CATCTGCCCCCTTAGCAATCAGG - Intergenic
1127117257 15:55741662-55741684 CACCTTCCTCCTGATCGTTGTGG + Intronic
1129514534 15:76148977-76148999 CACCTCCATCCTGAGAGTTCTGG + Intronic
1134004225 16:10807102-10807124 CCCCTGTCCCCTGAGCTTTTGGG - Intronic
1135323120 16:21510022-21510044 CACCTGCCCCCTCACCTGTCAGG + Intergenic
1136024970 16:27463292-27463314 CACCAGCGCCCTGGGCATTCTGG + Intronic
1137714775 16:50592035-50592057 CACCTGCCCCATTTGCATTCTGG + Intronic
1139654227 16:68377581-68377603 CAGCTGCCCCCTGAGCCCTCAGG - Intronic
1141762817 16:86039731-86039753 CACCTGCCCCTTCAGCATGCCGG - Intergenic
1142035317 16:87859044-87859066 CACCTGCCCCCTCACCTGTCAGG + Intronic
1143747776 17:9006058-9006080 CACCTGCCCCTTCAGCATGCTGG + Intergenic
1144430932 17:15191220-15191242 CACGTGCCCACTGAGGCTTCGGG - Intergenic
1147946833 17:44085080-44085102 CACGTGCACCCTGAGCATGCTGG - Exonic
1149409422 17:56389958-56389980 CACTTGCCCACTGATTGTTCAGG + Intronic
1149851327 17:60037187-60037209 CACCTGCCTCCTGCGGGTTGTGG + Intergenic
1150809666 17:68346740-68346762 CACCTGCACCCTGGGCCTCCTGG + Intronic
1152150557 17:78597493-78597515 AACCTGCCCCCTGGGCCTGCTGG - Intergenic
1152183612 17:78840613-78840635 CACGTTCTCCCTGAGCGTCCCGG + Exonic
1152732506 17:81979284-81979306 CCCCTGCCCCCTGAACATACTGG + Intronic
1152801838 17:82334253-82334275 CACCTGCGGCCTGGGCCTTCAGG + Intergenic
1152841297 17:82570407-82570429 CACCTGAGCCCTGGGAGTTCAGG + Intronic
1153547172 18:6219750-6219772 CCCCTTCTTCCTGAGCGTTCAGG - Intronic
1154974854 18:21447596-21447618 AACCAGGCCCCTGAGCTTTCAGG + Intronic
1156551884 18:38027200-38027222 CACATGCCCACTGAGGCTTCAGG - Intergenic
1158962918 18:62601384-62601406 CACATGCCCCCTGAGCTGTGGGG - Intergenic
1160793776 19:934589-934611 CACCTGCCCCCTGGGTGTACCGG + Intronic
1164890700 19:31820838-31820860 AACCTGCCTTCTGAGCTTTCAGG - Intergenic
1166109499 19:40613640-40613662 CAGCTGCCCCCTGATCCTGCTGG - Intronic
1166375283 19:42324226-42324248 CATCTGCCCCCCGAGGGTCCCGG + Intronic
1166707177 19:44914551-44914573 CCCCTGTCCCGTGAGCGTTGGGG - Intronic
1168033085 19:53696998-53697020 CACCTGCCACCTCAGCCTCCTGG + Intergenic
926395762 2:12440733-12440755 CTCCTCCTCCCTGAGGGTTCAGG - Intergenic
931640011 2:64373738-64373760 CATCTCCTCCATGAGCGTTCTGG - Intergenic
932376451 2:71240330-71240352 CACATGCCCCCTGAGCTTTAGGG + Intergenic
941466445 2:165833107-165833129 CACATGGCCCCTGAGTGGTCAGG - Intergenic
943319764 2:186432713-186432735 CATCTGGCCCCTGGGTGTTCAGG - Intergenic
946173579 2:217909407-217909429 CACCTGCCCCAGGCCCGTTCAGG + Intronic
1169199015 20:3698696-3698718 CAGCTGCCCTCTGACAGTTCCGG + Intronic
1175912240 20:62410508-62410530 CACCTGCTCCCTGAGGGGTGTGG - Exonic
1177601268 21:23318035-23318057 CACACGCCCACTGGGCGTTCAGG - Intergenic
1178491798 21:33057217-33057239 AACCTGACCCCTGAGCTTTTGGG - Intergenic
1178996378 21:37404441-37404463 CACCTGGCCCATGTGCATTCTGG + Intronic
1179709874 21:43207137-43207159 CACCTGCCCAGTGAGCCGTCGGG + Intergenic
1182353803 22:29713180-29713202 CACCTGTCCCCTGGGCTTTCTGG - Intergenic
1183493284 22:38127955-38127977 CTCCTGTCCCCAGGGCGTTCAGG - Intronic
1183588227 22:38765480-38765502 CACCTGCTCTCTCAGCGCTCAGG + Intronic
1184586635 22:45452494-45452516 CATCTGCACCCTGAGTGTCCTGG - Intergenic
1185290734 22:50025910-50025932 CACCTGCCACGTGAGAGTCCTGG - Intronic
949636615 3:5989297-5989319 CAGATGCCCCCTGAGAGGTCTGG - Intergenic
950124588 3:10503577-10503599 CACCCGCCCCCTCAGCTTCCAGG - Intronic
952159709 3:30681461-30681483 GACCTGCCCTCTGAGGGTTGTGG + Intronic
953043576 3:39276135-39276157 CACATGCTCCCAGAGTGTTCAGG + Intronic
953928448 3:46994160-46994182 CACCTGCCCAGTGAGCTTTAGGG - Intronic
954564722 3:51589904-51589926 CACCTTCCCTATGAGTGTTCTGG - Intronic
964011671 3:151899196-151899218 CACCTACCCTCTGAGCCTTCAGG + Intergenic
969502152 4:7559670-7559692 CACCTGCCCACTGTGCCATCTGG + Intronic
972413766 4:38818884-38818906 CACGTGCCCCCTGGGGGTTCAGG + Intronic
974805805 4:66879068-66879090 CATCTGCCCACTGAGCTTCCTGG - Intergenic
984024144 4:174522621-174522643 CACCTGCCCCCTGAGCGTTCTGG + Exonic
985666643 5:1184561-1184583 CACCTGACCCCAGGGCGTACAGG - Intergenic
985727964 5:1525512-1525534 CACCTGCTGCCTGAGTGCTCTGG + Intergenic
985754236 5:1703672-1703694 CACCTGCACCCTGTGCTTCCTGG - Intergenic
986165238 5:5267220-5267242 CACATGCCCACTGGGAGTTCAGG - Intronic
987370675 5:17189814-17189836 CTCCTGCTCCCTGAGCCTCCTGG - Intronic
988087072 5:26485848-26485870 CACATGCCCACTGGGCTTTCAGG + Intergenic
989955549 5:50355012-50355034 CACCTGCATCCTGACCATTCTGG + Intergenic
993452609 5:88091201-88091223 CACATGCCCTCTCAGTGTTCTGG + Intergenic
995142549 5:108749311-108749333 CACCCGCCCCCTCAGCCTTCGGG - Intronic
998191885 5:140032231-140032253 CACTTGCCACCTGAGCTTTTTGG - Intronic
998378394 5:141706663-141706685 TTCCTGCCCTCTGAGAGTTCAGG + Intergenic
1013946501 6:115728668-115728690 CACATGCCCACTGAGGCTTCAGG + Intergenic
1016841063 6:148525897-148525919 CACCAGACCCCTGAGGGATCTGG - Intronic
1019612970 7:1946164-1946186 CCCCTGCCCTCTGTGCATTCTGG + Intronic
1019815650 7:3197862-3197884 CCCCTCCCCCCTGAACCTTCAGG + Intergenic
1020100272 7:5390488-5390510 CTCCTGGCCCCTGACCTTTCTGG + Exonic
1020116494 7:5479393-5479415 CACAGGCCCCCTGAGGGTCCGGG + Intronic
1026913456 7:74106169-74106191 GACCAGCCCCCTGAGCTCTCCGG + Exonic
1031232337 7:119123875-119123897 CACATGCCCACTGGGGGTTCAGG + Intergenic
1032475786 7:132210755-132210777 CACCTGCCCCAGCAGCGTGCTGG - Intronic
1035162810 7:156963429-156963451 CTCCTGCCCCGTGAGCGTTCAGG - Intronic
1036008278 8:4692143-4692165 AACCTGCCCCCTGTCCCTTCTGG + Intronic
1040416217 8:47198233-47198255 CACCTGCACCCTGAGCAGTGGGG - Intergenic
1044521678 8:93206000-93206022 CACCAGCCCCATGAGCCTTGAGG + Intergenic
1048039349 8:130710517-130710539 CACCTGCTCCCTGAGGGTTAAGG + Intergenic
1049342221 8:142119235-142119257 CACCTGGCCACTCTGCGTTCAGG + Intergenic
1049659307 8:143812631-143812653 CAGCTGCCTCCTCAGCCTTCTGG + Intronic
1050330466 9:4540517-4540539 CACATGCCCTCTGGGCCTTCAGG + Intronic
1052336994 9:27330335-27330357 GACCAGCCCCTTGACCGTTCTGG - Exonic
1059308017 9:113369849-113369871 CACCTGCCCCGCAAGGGTTCTGG + Exonic
1060973966 9:127754319-127754341 CTCCTGCCCCCTGAGCCCCCTGG - Intronic
1061502922 9:131013965-131013987 CTCCTGCTCCCTGGGGGTTCTGG + Intronic
1062464851 9:136676405-136676427 CACTTGCCCCCTGACCGACCAGG - Intronic
1186461391 X:9751160-9751182 CACCTGGCCCCTTAGCGTAGTGG - Intronic
1189364837 X:40380465-40380487 CACCTGCCCTCTGGGCTTTGAGG + Intergenic
1198343893 X:135741012-135741034 AACCTGCCCTCTGAGAGTTGTGG - Intergenic
1200150069 X:153946991-153947013 CACCTTGCCCCGGAGCTTTCTGG + Intergenic