ID: 984025475

View in Genome Browser
Species Human (GRCh38)
Location 4:174538581-174538603
Sequence ATGTCCAAAACTCAAGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984025475_984025481 19 Left 984025475 4:174538581-174538603 CCAGAAACTTGAGTTTTGGACAT No data
Right 984025481 4:174538623-174538645 GCAGTGCCTGGAGTCTTCTCAGG No data
984025475_984025485 28 Left 984025475 4:174538581-174538603 CCAGAAACTTGAGTTTTGGACAT No data
Right 984025485 4:174538632-174538654 GGAGTCTTCTCAGGGGTGCTAGG No data
984025475_984025479 7 Left 984025475 4:174538581-174538603 CCAGAAACTTGAGTTTTGGACAT No data
Right 984025479 4:174538611-174538633 CATGGTTCCTCTGCAGTGCCTGG No data
984025475_984025482 20 Left 984025475 4:174538581-174538603 CCAGAAACTTGAGTTTTGGACAT No data
Right 984025482 4:174538624-174538646 CAGTGCCTGGAGTCTTCTCAGGG No data
984025475_984025483 21 Left 984025475 4:174538581-174538603 CCAGAAACTTGAGTTTTGGACAT No data
Right 984025483 4:174538625-174538647 AGTGCCTGGAGTCTTCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984025475 Original CRISPR ATGTCCAAAACTCAAGTTTC TGG (reversed) Intergenic
No off target data available for this crispr