ID: 984025478

View in Genome Browser
Species Human (GRCh38)
Location 4:174538604-174538626
Sequence CTGCAGAGGAACCATGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984025478_984025481 -4 Left 984025478 4:174538604-174538626 CCAGGCACATGGTTCCTCTGCAG No data
Right 984025481 4:174538623-174538645 GCAGTGCCTGGAGTCTTCTCAGG No data
984025478_984025483 -2 Left 984025478 4:174538604-174538626 CCAGGCACATGGTTCCTCTGCAG No data
Right 984025483 4:174538625-174538647 AGTGCCTGGAGTCTTCTCAGGGG No data
984025478_984025482 -3 Left 984025478 4:174538604-174538626 CCAGGCACATGGTTCCTCTGCAG No data
Right 984025482 4:174538624-174538646 CAGTGCCTGGAGTCTTCTCAGGG No data
984025478_984025485 5 Left 984025478 4:174538604-174538626 CCAGGCACATGGTTCCTCTGCAG No data
Right 984025485 4:174538632-174538654 GGAGTCTTCTCAGGGGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984025478 Original CRISPR CTGCAGAGGAACCATGTGCC TGG (reversed) Intergenic
No off target data available for this crispr