ID: 984025481

View in Genome Browser
Species Human (GRCh38)
Location 4:174538623-174538645
Sequence GCAGTGCCTGGAGTCTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984025478_984025481 -4 Left 984025478 4:174538604-174538626 CCAGGCACATGGTTCCTCTGCAG No data
Right 984025481 4:174538623-174538645 GCAGTGCCTGGAGTCTTCTCAGG No data
984025475_984025481 19 Left 984025475 4:174538581-174538603 CCAGAAACTTGAGTTTTGGACAT No data
Right 984025481 4:174538623-174538645 GCAGTGCCTGGAGTCTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984025481 Original CRISPR GCAGTGCCTGGAGTCTTCTC AGG Intergenic
No off target data available for this crispr