ID: 984025485

View in Genome Browser
Species Human (GRCh38)
Location 4:174538632-174538654
Sequence GGAGTCTTCTCAGGGGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984025478_984025485 5 Left 984025478 4:174538604-174538626 CCAGGCACATGGTTCCTCTGCAG No data
Right 984025485 4:174538632-174538654 GGAGTCTTCTCAGGGGTGCTAGG No data
984025480_984025485 -9 Left 984025480 4:174538618-174538640 CCTCTGCAGTGCCTGGAGTCTTC No data
Right 984025485 4:174538632-174538654 GGAGTCTTCTCAGGGGTGCTAGG No data
984025475_984025485 28 Left 984025475 4:174538581-174538603 CCAGAAACTTGAGTTTTGGACAT No data
Right 984025485 4:174538632-174538654 GGAGTCTTCTCAGGGGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984025485 Original CRISPR GGAGTCTTCTCAGGGGTGCT AGG Intergenic
No off target data available for this crispr