ID: 984026503

View in Genome Browser
Species Human (GRCh38)
Location 4:174549102-174549124
Sequence GATTCCATGACAGCTAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984026503_984026506 16 Left 984026503 4:174549102-174549124 CCATCTCTAGCTGTCATGGAATC No data
Right 984026506 4:174549141-174549163 TTCCATATCTCTGTGAGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984026503 Original CRISPR GATTCCATGACAGCTAGAGA TGG (reversed) Intergenic
No off target data available for this crispr