ID: 984035097

View in Genome Browser
Species Human (GRCh38)
Location 4:174657407-174657429
Sequence TTGTATAAGGAGAAGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1189
Summary {0: 1, 1: 0, 2: 5, 3: 135, 4: 1048}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984035097 Original CRISPR TTGTATAAGGAGAAGGAAAA AGG Intronic
900762826 1:4484221-4484243 TTAAAGAAGGAGAAGGAAAAGGG - Intergenic
901269636 1:7941983-7942005 GAGTATAAGGAGAAAGAAGAGGG + Intronic
901269662 1:7942175-7942197 AAGAATGAGGAGAAGGAAAAAGG + Intronic
901958215 1:12803131-12803153 TTGTATAAGGTGAAAGGAAGGGG + Intergenic
901966210 1:12869031-12869053 TTGTATAAGGTGAAAGGAAGGGG + Intronic
902153757 1:14466322-14466344 TTTTATAAGGAAAACAAAAAAGG + Intergenic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903467246 1:23560099-23560121 TTGCAGAAGGAGGAGGGAAAGGG + Intergenic
904879125 1:33681420-33681442 TTACATAAGAAGAAGTAAAATGG - Intronic
904993009 1:34608879-34608901 TTGAATAGGAATAAGGAAAACGG - Intergenic
905950710 1:41948280-41948302 TAGAATTAGGAGAAGGAAAAAGG + Intronic
906016232 1:42582809-42582831 TTGTAACAGGAGAAGAAACATGG - Intronic
906081832 1:43095887-43095909 TTGTATAAGGTGTAGGGAAGGGG - Intergenic
906583737 1:46957656-46957678 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
906893922 1:49750267-49750289 TTGTATAAGGTGTAGGGAAGGGG + Intronic
907037487 1:51229240-51229262 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
907157409 1:52347108-52347130 TTTTTTATGGAGAAGGAGAAAGG - Intronic
907366627 1:53966201-53966223 GTGTTTATGGAGAGGGAAAAAGG + Intronic
907388438 1:54140865-54140887 TTATATAAGGAGTTGAAAAAAGG + Intronic
907622031 1:55991388-55991410 TTGTATAAGAAGACCGAAACAGG - Intergenic
907882368 1:58563063-58563085 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
908074541 1:60501246-60501268 TTGTATAAGGAGTGAGACAAGGG - Intergenic
908279159 1:62512427-62512449 ATTTATAAGGAAAAGGAAGATGG + Intronic
908594409 1:65671503-65671525 TTGTATAAGGTGTAAAAAAAGGG - Intergenic
908598723 1:65716070-65716092 TTGTATACAGAGAAGGATAAGGG + Intergenic
909031341 1:70544950-70544972 ATGTTTCAAGAGAAGGAAAATGG + Intergenic
909110332 1:71468111-71468133 TGGTTTAAGGAAAAGGCAAACGG - Intronic
909591755 1:77357887-77357909 TTCTATCAAGAGAAGGAAAATGG + Intronic
909956227 1:81782263-81782285 TTCAATAAGAAGAAGGAAACAGG - Intronic
909963074 1:81872104-81872126 TTGTATAAGGTGTAAGGAAAGGG + Intronic
909972914 1:82011676-82011698 TTGTATACGGTGAAAGAAAGGGG + Intergenic
910004535 1:82380366-82380388 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
910172766 1:84396110-84396132 TGTAATAAGGAGAAGAAAAAAGG + Intergenic
910393322 1:86766705-86766727 TTGTATATGGTGAAAGGAAAGGG + Intergenic
910804815 1:91179889-91179911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
910925426 1:92393299-92393321 TTGTATAAGGTGTAAGGAAAGGG - Exonic
911087006 1:93987508-93987530 TGGGAGAAGGAGAAGGAAAGAGG - Intergenic
911344345 1:96678286-96678308 TTGTATAAGTTTATGGAAAAAGG - Intergenic
911360387 1:96868750-96868772 TCTTATAAGGTGAAGGAAACTGG + Intergenic
911362571 1:96897239-96897261 TTTTATAAGGTGAAGGGAAGGGG + Intergenic
911519370 1:98910131-98910153 TTTTGTATGGAGAAGGCAAAGGG - Intronic
911648401 1:100359874-100359896 TTGGATGAAGAGAAGAAAAAGGG - Intronic
912299181 1:108496162-108496184 TTGTATAAGGAGTAAGGAAGGGG - Intergenic
912341184 1:108917154-108917176 TTGTTTAGAGAAAAGGAAAATGG - Intronic
912599410 1:110913139-110913161 TTGTATATGGTGAAAGAAAGAGG - Intergenic
912957064 1:114162315-114162337 TTGTATATGGTGAAAGAGAAGGG - Intergenic
912980155 1:114364157-114364179 TTTTACAAGCAGTAGGAAAAAGG + Intergenic
913008428 1:114658146-114658168 AGGTTTAAGGAGAAGGAAGAAGG + Intronic
913069930 1:115289653-115289675 TTGTATGCAGAGAAGGAAGATGG - Intronic
913468686 1:119169523-119169545 TAGAATTAGGAGAAAGAAAAAGG - Intergenic
913556292 1:119970508-119970530 ATGTACTAGGAGATGGAAAAAGG + Intronic
914216037 1:145629421-145629443 TTGGCAAAGGAGAAGGACAAAGG + Intronic
914415406 1:147476825-147476847 TTATAGAAGGAAAAGAAAAAAGG - Intergenic
914468605 1:147952074-147952096 TTGGCAAAGGAGAAGGACAAAGG + Intronic
914995622 1:152541104-152541126 TTGTATTGGGAGATGGAAAAGGG - Intronic
915002912 1:152609777-152609799 TTGTATTGGGAGATGGAAAAGGG + Intergenic
915036872 1:152935186-152935208 ATGGAAAAGGAGGAGGAAAAAGG + Intergenic
915075249 1:153302847-153302869 GCGTATAAGCAGAAGGGAAAGGG + Intronic
915851387 1:159327771-159327793 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916848591 1:168679440-168679462 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
917037247 1:170762200-170762222 TTGTATAAGGTGTAAGGAAAAGG - Intergenic
917062831 1:171058813-171058835 TTGTATAAGGTGTAAGGAAAGGG - Intronic
917313572 1:173702453-173702475 GTTTATAAGGAGAAGAAAAGAGG + Intergenic
917584441 1:176411828-176411850 TTGTATAAGGTGAAAGGAAGGGG + Intergenic
918196185 1:182224190-182224212 TTGTATAAGCTGTAAGAAAAGGG - Intergenic
918230279 1:182523686-182523708 TTGAATAAGGGGTAGGGAAAAGG - Intronic
918319413 1:183350389-183350411 TGATAAAGGGAGAAGGAAAAAGG + Intronic
918356617 1:183710872-183710894 GTGGATAACTAGAAGGAAAAGGG + Intronic
918786794 1:188773846-188773868 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
918934296 1:190900091-190900113 TTTCATAAGGAGAAGAACAAGGG + Intergenic
918974372 1:191462947-191462969 TTGTATATGGTGTAGGGAAAGGG - Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919288946 1:195603318-195603340 TTGTATAAGGTGAGAGATAAAGG + Intergenic
920425113 1:205868867-205868889 TAGAATTAAGAGAAGGAAAAGGG - Intergenic
921217851 1:212951911-212951933 TTGTAGCAGGACTAGGAAAATGG - Intronic
921296394 1:213707714-213707736 TTGTATAAGGTGTAAGAAACGGG + Intergenic
921339064 1:214116331-214116353 TTATTTAAGGAAAAGGCAAAGGG - Intergenic
922147522 1:222962748-222962770 TTGTATAAGGAGTAAGGAAGGGG - Intronic
922908244 1:229192929-229192951 TTGTGTCAGGAGTAGGGAAAAGG - Intergenic
923062147 1:230485554-230485576 ATGAAAAAAGAGAAGGAAAAAGG - Intergenic
923431941 1:233931105-233931127 TTGTATAAGGTGTAAGAAAGGGG - Intronic
924296472 1:242591891-242591913 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
924506219 1:244687233-244687255 TTTAATAAGGAGAATGAAAAGGG - Intronic
924827937 1:247561623-247561645 TAATAAATGGAGAAGGAAAATGG - Intronic
924865184 1:247971592-247971614 TTGTATAAGGTGTAAGAAAGGGG + Intronic
924887505 1:248235177-248235199 TTGTATAAGGTGTAAGATAAAGG + Intergenic
1063045384 10:2387045-2387067 TTTTAAAAGGAAAACGAAAAAGG - Intergenic
1063110274 10:3029611-3029633 TAATAGAGGGAGAAGGAAAAAGG + Intergenic
1063774812 10:9250806-9250828 TTGTATAAGGTGAAAGATAAGGG - Intergenic
1063875159 10:10468413-10468435 TTGTAACAGGAGATGGAACATGG - Intergenic
1064048181 10:12037937-12037959 AAGAAAAAGGAGAAGGAAAAAGG - Intronic
1064313357 10:14232102-14232124 TTGTATATGGAGAAAGGAAGGGG + Intronic
1064344077 10:14514922-14514944 TTGTATAAGGAGTAAGGAAGGGG - Intergenic
1064477827 10:15710415-15710437 TTTTTTAAGAAGAAAGAAAAGGG - Intronic
1064821802 10:19344588-19344610 TTGTATAAGAAGAATGAATTAGG - Intronic
1064853443 10:19737036-19737058 TTGTATAAGGTGTAAGGAAAGGG - Intronic
1065198243 10:23287444-23287466 TTGTATAAGGTGTAAGGAAAGGG - Intronic
1065199184 10:23297454-23297476 TAGAATTAAGAGAAGGAAAAAGG - Intronic
1065652859 10:27911745-27911767 TGGTATGAGGGGCAGGAAAAGGG - Intronic
1065798122 10:29325743-29325765 TTGAATAAAGAAAAGGAAAGAGG + Intergenic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1066087733 10:31987454-31987476 GTGTATAAGGTGTAGGAAAGGGG - Intergenic
1067207028 10:44227140-44227162 TTGTATAAGGTGTAAGGAAATGG + Intergenic
1067573829 10:47393098-47393120 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1067713179 10:48666523-48666545 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1068066772 10:52141797-52141819 TTTAAGAAGGAGAAGTAAAAGGG + Intronic
1068253744 10:54479565-54479587 TTCTATGAGGATGAGGAAAAGGG - Intronic
1068430992 10:56931960-56931982 TTGTACAAGGGGAAGGATGAGGG + Intergenic
1068583050 10:58764669-58764691 TTGTTTTAGGAGAAAGAAAGTGG - Intronic
1068791497 10:61035396-61035418 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
1069055862 10:63844088-63844110 AAGGATAAGGAGAAGGAAATAGG - Intergenic
1069069501 10:63978746-63978768 TTGCACTAGGAGAAGGCAAAGGG - Intergenic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1069254201 10:66311755-66311777 TTGTATATGGAAAAGGAATATGG + Intronic
1069322073 10:67184346-67184368 ATGTAAAAGGAGATGGAACATGG - Intronic
1069328201 10:67258066-67258088 TTGCATATGTAGAAGGAACAAGG - Intronic
1070239677 10:74666471-74666493 TTGTAAAGTGAGAAGGAAAAGGG - Intronic
1070451966 10:76568177-76568199 TTGTATAAAAAGAAGGGATATGG - Intergenic
1070605876 10:77898304-77898326 TTGGAGAAGGAGAGAGAAAAAGG + Intronic
1071076791 10:81764372-81764394 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1071326908 10:84527030-84527052 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1071402411 10:85287176-85287198 TTCTTTAAGCTGAAGGAAAAAGG + Intergenic
1071436645 10:85653742-85653764 TTTTATAAGGAGAAGAAGAGAGG + Intronic
1071440943 10:85693753-85693775 TTGTATATGGTGAAAGATAAGGG - Intronic
1071577560 10:86740533-86740555 TTAAACAAGCAGAAGGAAAAAGG - Intergenic
1071701047 10:87936653-87936675 GTGTATAAGAAGGAGGAAAGAGG - Intronic
1071746181 10:88421921-88421943 TTGTATAATGAGCAGTAAAGAGG - Intronic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1072377785 10:94835785-94835807 TAGAATTAGGAAAAGGAAAAAGG - Intronic
1072387412 10:94945338-94945360 TTGTATAAGGTGTAAGGAAAGGG - Intronic
1072471590 10:95718638-95718660 TAGAATTAGAAGAAGGAAAAAGG - Intronic
1073779220 10:106818826-106818848 TTGTCAAAGGAGAAGGGGAAAGG - Intronic
1074016313 10:109537787-109537809 TTGTATAAGGTGTAAGCAAAGGG + Intergenic
1074036645 10:109745801-109745823 TTGTAAAAAGATAAAGAAAAAGG - Intergenic
1074072955 10:110091604-110091626 TTGTATATGGTGAAAGGAAAAGG - Intronic
1074095958 10:110312755-110312777 TTATAAAAAGAGAAAGAAAACGG + Intergenic
1074348745 10:112714188-112714210 TTTTATAAGGAGAGTGGAAATGG + Intronic
1074645966 10:115452841-115452863 TGGGATAGGGAGAAAGAAAAGGG - Intronic
1075230858 10:120676129-120676151 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075510225 10:123066561-123066583 TTGAATAGGGAGAAGAGAAAAGG - Intergenic
1076455703 10:130592806-130592828 TTGTATAAGGTATAAGAAAAAGG - Intergenic
1077392436 11:2306410-2306432 TAGAATGAGGAGAAAGAAAATGG + Intronic
1077731977 11:4741087-4741109 TTGTATAAGGTGTAAGGAAAGGG + Intronic
1078628173 11:12977615-12977637 TTGCAAAAGGAAAAGAAAAAAGG + Intergenic
1078683207 11:13500229-13500251 TTGTGGATGGAGAGGGAAAATGG + Intergenic
1078808983 11:14738774-14738796 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1078813617 11:14797036-14797058 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1079157822 11:17964939-17964961 CTGTACAAGGAGCAGGAAACAGG + Intronic
1079192149 11:18287971-18287993 GTGTATATGGAGATGGAAAAAGG - Exonic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079798311 11:24835277-24835299 TTGTATAAGGTGTAAGGAAAGGG - Intronic
1079887259 11:26003793-26003815 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1079933624 11:26593244-26593266 TTGAATTAGGAGAAGGAAAAAGG - Intronic
1080369026 11:31612615-31612637 GTATATAAGGAGAAAGAGAAGGG + Intronic
1080415388 11:32065432-32065454 TTGGATGAGGAGAATGAAGAAGG - Intronic
1080515800 11:33018647-33018669 TTTTAAAAGTAGAAAGAAAAGGG - Intronic
1080820817 11:35804761-35804783 TTGTATAACCAGCAGGAAAGGGG + Intronic
1080889861 11:36400120-36400142 TTAAATAAGCAGAGGGAAAAAGG + Intronic
1081056722 11:38418231-38418253 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1082668903 11:56009514-56009536 TTGTATATGGTGAAAGATAAAGG - Intergenic
1082754632 11:57062422-57062444 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1083495470 11:63048095-63048117 TTATATGAGGACAAGGATAAGGG + Intergenic
1083499669 11:63092660-63092682 TTATATAAGGTGTAGGAAAGGGG - Intronic
1084683216 11:70679230-70679252 TTGTAAAATGGGAAAGAAAATGG - Intronic
1084985075 11:72862254-72862276 TTTTATAGTAAGAAGGAAAAAGG + Intronic
1085601444 11:77859523-77859545 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086441659 11:86834798-86834820 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1086566590 11:88233829-88233851 ATGGATAGGGAGGAGGAAAACGG - Intergenic
1087194369 11:95290539-95290561 CTGTTGAAGGAGAGGGAAAATGG + Intergenic
1087434323 11:98094459-98094481 TTGTATAAGGTGTAGGGAAGGGG - Intergenic
1087834374 11:102857638-102857660 TTCTTCAAGTAGAAGGAAAATGG - Intergenic
1087939468 11:104077873-104077895 TTTTTGAAGGAGAAGGGAAAGGG - Intronic
1088167106 11:106951909-106951931 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1088644095 11:111902552-111902574 TTGGATAAGGAGGATGAGAAAGG - Intergenic
1088953389 11:114592994-114593016 TTGTATATGGTGAGAGAAAATGG - Intronic
1088960180 11:114655497-114655519 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1088969620 11:114761534-114761556 TTGGCTAGGGACAAGGAAAAGGG - Intergenic
1089312690 11:117570336-117570358 CTGTCTAAGGAGAAGCAGAACGG - Intronic
1089991691 11:122867388-122867410 TTCTATAAGGAAAATGAAAAAGG - Exonic
1090616036 11:128516106-128516128 TTATACAATCAGAAGGAAAAGGG + Intronic
1090690060 11:129171343-129171365 TTGTATAAGGTGAAAGGAAGGGG + Intronic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1090886088 11:130878111-130878133 TGGCAAAAGGAGAAGCAAAAGGG + Exonic
1091064973 11:132501198-132501220 TTGTATAAGGTGTAAGGAAAGGG - Intronic
1091096859 11:132831532-132831554 ATGTCTAAGTAGAGGGAAAATGG - Intronic
1091204782 11:133812729-133812751 GTGTAAAAACAGAAGGAAAATGG + Intergenic
1091512560 12:1144060-1144082 AAGTAGAAGGAGAAGGAAATGGG - Intronic
1091856281 12:3742946-3742968 TTGTACTAGGAAAAAGAAAAAGG - Intronic
1091925148 12:4340858-4340880 TTGTATATGGAGAAAGACAGGGG - Intronic
1092480013 12:8851352-8851374 TTGTATGGGGAGAAGTAAAGAGG - Intronic
1092516128 12:9215487-9215509 TTGTATAAAAAGAAAGAGAAAGG - Intergenic
1092519393 12:9252173-9252195 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1092625858 12:10327626-10327648 TTGTAAAAGAAGAAGTACAATGG - Intergenic
1093084554 12:14852403-14852425 TGGGAGAAGGAGAAGGAGAAGGG - Intronic
1093104599 12:15070893-15070915 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1093151345 12:15625441-15625463 CTGTAAAAGGAGCAGAAAAATGG - Intronic
1093348671 12:18070447-18070469 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1093375613 12:18423705-18423727 TTGTATATGGATAAGAAATAAGG - Intronic
1093476121 12:19556421-19556443 TTGTATATGGAGAAAGATAGGGG + Intronic
1093952449 12:25178996-25179018 TTATATTAGAAGAAGAAAAAAGG - Intronic
1094061612 12:26320160-26320182 TAATATATGGGGAAGGAAAATGG + Intergenic
1094179040 12:27571427-27571449 TGGTAAAATGAGAGGGAAAATGG + Intronic
1094555056 12:31490763-31490785 TTGTAAGAGTAAAAGGAAAAAGG - Intronic
1094806779 12:34101709-34101731 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1094846771 12:34364787-34364809 TTGTGGAAGGAAAAGAAAAAGGG - Intergenic
1094848436 12:34371688-34371710 TTGTGGAAGGAAAAGAAAAACGG - Intergenic
1094871781 12:34602879-34602901 TTGTGTAAGGAAAAAAAAAATGG + Intergenic
1095139070 12:38640298-38640320 TAGAATTAGGATAAGGAAAAAGG + Intergenic
1095259034 12:40077324-40077346 TTGTATATGAAGAAAGGAAAGGG + Intronic
1096211533 12:49769889-49769911 GTGTAAAAGGAAAAGAAAAAGGG + Intergenic
1096351752 12:50906452-50906474 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1096900040 12:54867650-54867672 TTGTATATGGTGAAAGGAAAGGG + Intergenic
1097376930 12:58853527-58853549 TAGAATTCGGAGAAGGAAAAAGG - Intergenic
1097743085 12:63268183-63268205 TCGTTTCTGGAGAAGGAAAAAGG - Intergenic
1097880374 12:64681149-64681171 AAGAATGAGGAGAAGGAAAAGGG - Intronic
1098003850 12:65974225-65974247 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1098020046 12:66145250-66145272 TTGTAACAGGAAAAAGAAAACGG + Intronic
1098160830 12:67647793-67647815 TTGTATATGGCGAATAAAAAAGG + Intergenic
1099021423 12:77409333-77409355 TTTTATAAGAGGAAGGAAACAGG + Intergenic
1099397749 12:82162055-82162077 TTGAATAAGGAAAAGAAAATAGG - Intergenic
1100094629 12:91017759-91017781 TCATATAAGGAAAAGAAAAAAGG + Intergenic
1100099192 12:91081702-91081724 TGCCATAAGGAGAAGGAAATAGG - Intergenic
1100308014 12:93369046-93369068 TGGCAGAAGGAGAAGGAGAAGGG - Intergenic
1100558089 12:95717740-95717762 CTAGATAAGGAGCAGGAAAATGG + Intronic
1100923069 12:99511881-99511903 TTGTATAAGGTGTAGGGAAGGGG - Intronic
1101009480 12:100434645-100434667 TAGTTCAAGGAGAAGAAAAACGG + Intergenic
1101472212 12:105008655-105008677 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1101529509 12:105561272-105561294 TTGTATACAGAGAAAGAAAATGG + Intergenic
1101666216 12:106818086-106818108 TTGTATAATATCAAGGAAAAAGG + Intronic
1102272649 12:111551537-111551559 TTGTCTAATGAAAATGAAAAAGG - Intronic
1102408767 12:112698837-112698859 AAGGAGAAGGAGAAGGAAAAGGG - Intronic
1103187008 12:118967203-118967225 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1103437659 12:120939344-120939366 TTGTATAGAGAGCATGAAAAGGG - Intergenic
1104091474 12:125521320-125521342 TGGAATAAGGAAAAGGAGAAGGG - Intronic
1104659244 12:130597927-130597949 TTGGAAAAGAAGGAGGAAAATGG + Intronic
1104851169 12:131874865-131874887 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1106757214 13:32834868-32834890 TTGTAATAGGAGATGGAACATGG + Intergenic
1106767041 13:32923518-32923540 TTGAAGTAGGAGAAAGAAAATGG + Intergenic
1107200389 13:37708833-37708855 ATGTATACGGAGAAGGAAAAAGG - Intronic
1107647095 13:42505585-42505607 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1107951810 13:45469098-45469120 TTGTATTAGAACAAGGAAACAGG + Intronic
1108130673 13:47296621-47296643 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1108237286 13:48421335-48421357 TTGTATAAGGTGTAAGAAAGGGG - Intronic
1108367291 13:49728560-49728582 TTGTAAAAGGAGATGAAACATGG + Intronic
1108787150 13:53918564-53918586 TTGTATATGGAGAAGAGGAAGGG + Intergenic
1108877000 13:55059821-55059843 TAGAATTAGGAGAAGGGAAAAGG + Intergenic
1108899499 13:55382642-55382664 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1109196245 13:59380670-59380692 TTGTATAAGGTGTAGGGAAGGGG - Intergenic
1109399575 13:61807898-61807920 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1109691423 13:65895816-65895838 ATGTATAAGTAAATGGAAAAAGG - Intergenic
1110743699 13:79027789-79027811 TCATGCAAGGAGAAGGAAAAGGG + Intergenic
1110825173 13:79963423-79963445 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1110998311 13:82142287-82142309 TTGTATAAACAGAAGTAAAGAGG - Intergenic
1111053331 13:82914880-82914902 TTGTATATGGTGAAAGATAAGGG - Intergenic
1111056575 13:82958122-82958144 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1111062699 13:83044244-83044266 TAGTATAAGTAAAGGGAAAATGG + Intergenic
1111067614 13:83117137-83117159 TTGTCTCAGGAGAAGGACAAAGG - Intergenic
1111407720 13:87831728-87831750 TTATTAAAGGAAAAGGAAAAAGG - Intergenic
1111422073 13:88025072-88025094 TTGTAAAAAGAGAAGCCAAATGG - Intergenic
1111740501 13:92198840-92198862 TACTAAAATGAGAAGGAAAATGG + Intronic
1111806290 13:93043292-93043314 TAGAATTAGGAGAAAGAAAAAGG + Intergenic
1112056727 13:95695647-95695669 TGGTATAAGGGCAAGGAAAATGG - Intronic
1112377420 13:98856017-98856039 TTGTATATGGAGAAGCTAAATGG + Exonic
1112531001 13:100203373-100203395 TTTTATAAGGCAAAGAAAAAGGG - Intronic
1112682571 13:101783850-101783872 TTGTATATGGTGCAAGAAAAGGG + Intronic
1112749476 13:102567449-102567471 TTGATTATGGAGAAAGAAAAGGG + Intergenic
1112939799 13:104847787-104847809 TTCCACAGGGAGAAGGAAAAAGG + Intergenic
1113131219 13:107039236-107039258 TTGTATAAGGTGAAAGGAAGGGG + Intergenic
1113393450 13:109920043-109920065 TTGCATCAGCAGAAAGAAAATGG + Intergenic
1113394643 13:109935530-109935552 TTGTATATGGAGTAAGAAAGGGG + Intergenic
1114366592 14:22033692-22033714 TTGTATAAGGTGTACGGAAAGGG + Intergenic
1114384636 14:22242470-22242492 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1114900691 14:27054051-27054073 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1115139866 14:30158377-30158399 TCGTAAAAGGAGAAAGAAAAAGG - Intronic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1115461327 14:33664337-33664359 TTGTATAAGGTGTAAGGAAAGGG - Intronic
1115574728 14:34699760-34699782 ATGTGTAAGGAGAAAGAAATTGG - Intergenic
1115742146 14:36399630-36399652 TGGTAGAAGGAGAGGGAAGAAGG - Intergenic
1115973129 14:38968163-38968185 TTGTATAAGGTGTAGGGAAGGGG - Intergenic
1115973938 14:38976361-38976383 TTGTATAAGGTGTAGGGAAGGGG + Intergenic
1116008975 14:39328638-39328660 TTGTATAAGGTGCAGGGAAGGGG + Intronic
1116276596 14:42841343-42841365 TTGTATAAGGAGCACAAACAAGG - Intergenic
1116378660 14:44235912-44235934 TTGTAGAGGGAGTAGGAATATGG + Intergenic
1116447128 14:45023008-45023030 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1116554386 14:46284883-46284905 TTGTATAAGGTGTAAGAAAGTGG - Intergenic
1116561653 14:46387025-46387047 TTGTATAAGGTGAAAGACACTGG + Intergenic
1117236846 14:53786951-53786973 ATGTTTAAGGAGAAAGAAAAAGG - Intergenic
1117363547 14:55002229-55002251 TTGAATTTGAAGAAGGAAAAAGG + Intronic
1117551852 14:56844703-56844725 TTATAGCAGGAAAAGGAAAAAGG - Intergenic
1117561371 14:56942656-56942678 TTGTATATGGTGAAAGAAAGGGG + Intergenic
1117870124 14:60191889-60191911 TTGTTAGAGAAGAAGGAAAAGGG + Intergenic
1118434809 14:65760785-65760807 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1118494286 14:66292888-66292910 TTCCACAAGGAGATGGAAAAGGG + Intergenic
1120055701 14:79921472-79921494 ATGTATAAGGAGAAAAAAAATGG + Intergenic
1120089999 14:80320516-80320538 TTTTTTATGTAGAAGGAAAATGG + Intronic
1120124787 14:80728561-80728583 TTCCAAAAGGAGGAGGAAAAGGG + Intronic
1120221044 14:81733957-81733979 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1120260370 14:82176940-82176962 TTGTACAAAGAGAAGGAGATTGG - Intergenic
1120323885 14:83001224-83001246 TTGTATAAGGGGCAGAAACAAGG + Intergenic
1120411550 14:84163449-84163471 ATGTATAAAGATAAGGGAAAAGG + Intergenic
1120507270 14:85368111-85368133 TTGTATAAGGTGTAAGAAATAGG + Intergenic
1123186062 14:106518055-106518077 TAGTGTCAGGAGAAGGAGAAGGG + Intergenic
1124146549 15:27132305-27132327 TTGTATAAGGTGAAAGATAGGGG + Intronic
1124224438 15:27880024-27880046 TTGTATAAGGTGTAAGGAAAGGG + Intronic
1124412740 15:29450401-29450423 TTGTATATGGTGAAGGGAACGGG + Intronic
1124790921 15:32725809-32725831 TTGTATAAGGTGTAGGGAAAGGG + Intronic
1125316248 15:38434959-38434981 TTGTATATGGTGAAAGATAAAGG + Intergenic
1125986947 15:44062832-44062854 TTGTATAAGGAGTATGATAAAGG + Intronic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126253320 15:46594503-46594525 TTGTATATGGAGTAAGGAAAGGG + Intergenic
1126363309 15:47868572-47868594 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1126470262 15:49002625-49002647 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1126520380 15:49586357-49586379 TTGTATAAGGTGCAAGGAAAAGG - Intronic
1126995159 15:54434552-54434574 TTGTATAAGGTGTAAGAAAGGGG - Intronic
1127001841 15:54517928-54517950 TTGTATAAATAGAGGTAAAAAGG + Intronic
1127056807 15:55140471-55140493 TTGTATAAGGTGTAGGGAAGGGG - Intergenic
1127073963 15:55308388-55308410 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1127105731 15:55612411-55612433 TAGTATATGGATAAGAAAAAAGG + Exonic
1127180815 15:56415408-56415430 TTGTATAAGGTGGAAGGAAAGGG + Intronic
1127341090 15:58044824-58044846 TTGGATGAGCAGAGGGAAAAGGG + Intronic
1127527993 15:59812996-59813018 TTGTTTAAGGAGGAGGAGACAGG - Intergenic
1127713332 15:61623612-61623634 TTCTATGAGGAAAAAGAAAAAGG + Intergenic
1127831942 15:62758710-62758732 CTTTAGAAGGAAAAGGAAAAAGG + Intronic
1128012647 15:64312573-64312595 TTGTATAAGGTGTAAGAAAGGGG - Intronic
1128446294 15:67764259-67764281 TTGTATAAGGAGAAGGGAACAGG + Intronic
1128848405 15:70923791-70923813 TGATATATGGAGAAGGAAAAAGG - Intronic
1129368931 15:75075519-75075541 TTGTATAAGAAAAAGTAAAATGG + Intronic
1129645597 15:77428334-77428356 TTGTAGAAAGAGCAGGCAAATGG + Intronic
1129990612 15:79959313-79959335 TTGGAGGAAGAGAAGGAAAAAGG + Intergenic
1131082248 15:89546454-89546476 TTGTGAAAGGAGAAGAAAAAGGG - Intergenic
1131150129 15:90042572-90042594 TTGGATGATCAGAAGGAAAAAGG + Intronic
1131420505 15:92300950-92300972 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
1131682163 15:94735336-94735358 TTGTAGGAGGAGAATCAAAATGG - Intergenic
1131875145 15:96798019-96798041 ATGGAGGAGGAGAAGGAAAAGGG + Intergenic
1133465604 16:6024334-6024356 TTTCATAAGGATAATGAAAAGGG + Intronic
1134395590 16:13859985-13860007 TTGTATAAGGTGACTCAAAAAGG - Intergenic
1134584334 16:15397160-15397182 TTTTATAAGGTGATGGAGAAAGG + Intronic
1135224833 16:20646711-20646733 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1135556455 16:23440985-23441007 ATATATATGGAGAGGGAAAAAGG + Intronic
1135681250 16:24459309-24459331 TTGCACTAGGAGAAAGAAAATGG - Intergenic
1135749288 16:25044141-25044163 TTTTACAAGGAGAATGAGAAAGG + Intergenic
1135751438 16:25061772-25061794 TTGCATAAGGGGAAAGAAAAAGG + Intergenic
1135933436 16:26759112-26759134 TTCAATAAGGAGAAAAAAAAAGG - Intergenic
1136081336 16:27854307-27854329 GAGGAAAAGGAGAAGGAAAAGGG + Intronic
1136647137 16:31631036-31631058 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1136659426 16:31743294-31743316 TTGTATAAGGTGCAAGAAAAGGG + Intronic
1137020176 16:35417242-35417264 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1137337131 16:47560934-47560956 TGGTATAAGGAAAAGGAAAATGG + Intronic
1139178553 16:64718526-64718548 GTTTATAGGGAGTAGGAAAATGG + Intergenic
1139221685 16:65188914-65188936 TTGGAAAAGGAGGAGGAAAATGG - Intergenic
1139263124 16:65614432-65614454 TTGTATAAGGTGAAAGGTAATGG + Intergenic
1140798960 16:78467153-78467175 TTTTTTAAAAAGAAGGAAAATGG - Intronic
1140946823 16:79776501-79776523 AAGTATCAGGAGAAGGCAAAAGG - Intergenic
1141326095 16:83060855-83060877 TTGTTTAAGGGGAAGTAAAGAGG - Intronic
1141640763 16:85339683-85339705 TTTTTTAAAGAGAAGAAAAATGG - Intergenic
1141773033 16:86102377-86102399 TTGTAAAAGGAAAAAGAAAGGGG - Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142792723 17:2280777-2280799 TTGTATAATTAGAAATAAAATGG + Intronic
1143983472 17:10891252-10891274 TTGTGGAGGGAGGAGGAAAAGGG - Intergenic
1144011216 17:11150120-11150142 ATGTATACGGGGAAGGAGAAAGG - Intergenic
1146237079 17:31176680-31176702 TTGTATAAGGTGTAAGGAAAGGG + Intronic
1146889017 17:36492942-36492964 TAGAATAAGTCGAAGGAAAAGGG + Intronic
1146997374 17:37333137-37333159 TAGAATTAGGAGCAGGAAAAAGG + Intronic
1147641260 17:42001882-42001904 TGCTAGAAGGAGAAGGCAAATGG + Intronic
1147855224 17:43474761-43474783 TTGTATCAGGAAAAAGAGAAGGG + Intergenic
1148826920 17:50400631-50400653 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1149105793 17:52962753-52962775 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1149131591 17:53308667-53308689 TTGTATACGGAGTGAGAAAAGGG - Intergenic
1149131845 17:53311956-53311978 TTGTATAGGGAGTGAGAAAAGGG - Intergenic
1149195329 17:54112743-54112765 TTGTAAAAGGAGATGAAACATGG + Intergenic
1149273760 17:55012643-55012665 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1149612591 17:57968414-57968436 ATGTATATGGAGGAAGAAAAAGG - Intergenic
1150015538 17:61553092-61553114 TTTTATAAAGGGAAGGGAAAGGG - Intergenic
1150352299 17:64455050-64455072 TTGTGAAAGGAAAAGGAAGAAGG + Intronic
1150830003 17:68511357-68511379 CTGTCTAAGGAGGAAGAAAAGGG - Intergenic
1150884029 17:69064407-69064429 TCCTATAAGGAGCAGGAAGATGG - Intergenic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1152763782 17:82124208-82124230 TTGTTTCAGGAGTAGGAACATGG + Intronic
1153148677 18:2063845-2063867 TTGAAAAAGGAGAAGGAAAAAGG + Intergenic
1153161838 18:2215257-2215279 TTTTTCAAGGAGAAGGACAAGGG + Intergenic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1154484738 18:14864819-14864841 TGGTAGATGGAGAAGGGAAAGGG - Intergenic
1154505271 18:15032398-15032420 TTTTAAAATGAGTAGGAAAATGG - Intergenic
1155050949 18:22147281-22147303 TTGTACAATGAGGAGGAGAAGGG + Intergenic
1155530050 18:26757936-26757958 CTGACAAAGGAGAAGGAAAATGG - Intergenic
1155578129 18:27271210-27271232 TTGTACCAGGAGAAGAAACATGG - Intergenic
1155612389 18:27681350-27681372 TTGTAAAAGCAGCAGGAAAGCGG - Intergenic
1155779773 18:29816390-29816412 TTGTATATGGTGAAATAAAAGGG - Intergenic
1155787882 18:29924880-29924902 TTGTATATGGTGAGAGAAAAGGG + Intergenic
1155856877 18:30845438-30845460 TTGTATAAGGAGTAAGGAAGGGG + Intergenic
1156103370 18:33626182-33626204 TTCATTAAGGAGAAGGAAAATGG + Intronic
1156121597 18:33849515-33849537 TTCTGTAAGGAAAAGTAAAAGGG - Intergenic
1156128558 18:33938949-33938971 TTGTATAAGGTGTAAGGAAAAGG + Intronic
1156261802 18:35451457-35451479 AAGGATAAGGAGAGGGAAAAGGG + Intronic
1156561283 18:38128568-38128590 TTTTATGTGGAGATGGAAAATGG + Intergenic
1156665080 18:39395040-39395062 TTGTATAAGGCATAAGAAAAGGG - Intergenic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1157066865 18:44360143-44360165 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1157487161 18:48096155-48096177 TTTTAGCAGGAAAAGGAAAAAGG + Intronic
1157577657 18:48754471-48754493 TTGTGCAGGAAGAAGGAAAAGGG + Intronic
1158184821 18:54759879-54759901 TGGTATAAGGAGCTGGAAAGGGG - Intronic
1158244929 18:55421631-55421653 TTGTATAATGATTAAGAAAAAGG - Intronic
1158500223 18:57994204-57994226 TTGGAAAAGGAGCAAGAAAAGGG - Intergenic
1158584851 18:58723286-58723308 TTGTATAATGAAAAGAATAATGG - Intronic
1158722745 18:59940244-59940266 TTGTATGTAGAGAAGGAATAAGG - Intergenic
1158786001 18:60712473-60712495 TAGAATTAGGAGAAGGGAAAAGG + Intergenic
1158903908 18:61992429-61992451 GTCTAAAATGAGAAGGAAAATGG + Intergenic
1159281959 18:66297074-66297096 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1159290646 18:66414522-66414544 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1159448700 18:68572780-68572802 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1159478322 18:68953762-68953784 TAGTCTGAGGAGAAGGCAAATGG + Intronic
1159632765 18:70767983-70768005 TTGTATAAGGTGAACAAAAGGGG - Intergenic
1160104040 18:75952736-75952758 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1160208326 18:76856047-76856069 TTTTTTAAAGAGAAAGAAAATGG - Intronic
1160373387 18:78392202-78392224 TTGTAGAAGGGGAACGAGAAAGG + Intergenic
1162549744 19:11351767-11351789 TTGTAGAAGGGGAGGGGAAAAGG + Intronic
1163900945 19:20099770-20099792 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1163946695 19:20543521-20543543 TTGTACAAATAGAAGGAATATGG - Exonic
1164053235 19:21600699-21600721 TTTCATAAGGAGGAGGAAACAGG - Intergenic
1164323041 19:24167813-24167835 TAGAATTAGGAGAATGAAAAAGG - Intergenic
1164643372 19:29842383-29842405 TGGTTTAAGGAAGAGGAAAATGG - Intergenic
1164792975 19:31003674-31003696 TTTTATAAAGTAAAGGAAAAGGG - Intergenic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1164963990 19:32463993-32464015 TCATAAAAGGAGATGGAAAAAGG - Intronic
1164996699 19:32725387-32725409 TTGTATAAGGTGTAAGGAAAGGG + Intronic
1165369320 19:35394000-35394022 GTGTATAAGTAGAAGGATAGTGG + Intergenic
1165405230 19:35626613-35626635 TTCAATAAAGAGAAGGCAAAAGG + Intergenic
1165810167 19:38607258-38607280 TTGTATAAGAAGATGGAAGGAGG + Intronic
1166165863 19:40987927-40987949 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1168095306 19:54111076-54111098 TTGAATAAGGAGGAGACAAAGGG + Intronic
1168135930 19:54351962-54351984 TTGTAGTAGGGGAAAGAAAATGG - Exonic
1168635007 19:57989365-57989387 CTGGAAAACGAGAAGGAAAAAGG + Intronic
925550888 2:5073104-5073126 TTCTCTAAGCAGAATGAAAATGG + Intergenic
927015511 2:18956041-18956063 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
927021558 2:19022276-19022298 TTCTAAAAGAAGAAAGAAAAGGG - Intergenic
927804232 2:26131583-26131605 TTTTAAAAGGAGAAAAAAAAAGG + Intronic
928037282 2:27836464-27836486 TTGTATATGGTGAAAGATAAGGG - Intronic
928282254 2:29958465-29958487 TTGTATATGGTGAAAGATAAAGG - Intergenic
928476556 2:31632828-31632850 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928677414 2:33663225-33663247 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928781957 2:34833909-34833931 AGGTAGAAGGAGAAGGAAAGAGG + Intergenic
928790432 2:34944973-34944995 TTGTTTAGGTATAAGGAAAAAGG + Intergenic
928805856 2:35153903-35153925 TTGTATATGGTGAAAGGAAAGGG - Intergenic
928850447 2:35739139-35739161 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
929029664 2:37638427-37638449 TTGTATAAGTCCAGGGAAAATGG - Intergenic
929312480 2:40441735-40441757 TTGTATAAGGTGTAGGGAAGGGG - Intronic
929835491 2:45393174-45393196 CTGTATAAGGAGATTGCAAAAGG - Intronic
930631649 2:53760177-53760199 TAGAATTAGGAGAAGGAAAAAGG + Intronic
931036881 2:58253730-58253752 TTGTTTAAGAAAAAGGAAAAAGG + Intergenic
931561021 2:63561037-63561059 TTGCATAAGGTGTAGGAAAGGGG - Intronic
932078023 2:68684342-68684364 TTGGAAAAGAAGAAGTAAAAAGG + Intronic
932145996 2:69317804-69317826 CTTTATAAGGAAGAGGAAAATGG + Intergenic
932745296 2:74329142-74329164 TTGTAGAAGTAGCAGTAAAACGG + Intronic
932757089 2:74416329-74416351 TTGTCTAGTGGGAAGGAAAAGGG + Intronic
932874364 2:75434799-75434821 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
932908279 2:75778202-75778224 TTGTATAAGGTGAAAGGAAGGGG - Intergenic
932917998 2:75877812-75877834 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
933174929 2:79164399-79164421 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
933270760 2:80230564-80230586 TTGAAAAAGCAGACGGAAAAGGG + Intronic
933283926 2:80363860-80363882 TGGTATTGGGAGAAGGGAAATGG - Intronic
933365378 2:81347181-81347203 ATTTATAAAGAGAAAGAAAAGGG + Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933872199 2:86577698-86577720 TTGTAAATGGAGAAGAAAAGGGG + Intronic
934019352 2:87929225-87929247 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
934114930 2:88779050-88779072 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
935050249 2:99519041-99519063 TTGTTCAAGAAGCAGGAAAAAGG + Intergenic
935319498 2:101872042-101872064 TTGGATAAAAAGAATGAAAAAGG - Intronic
935801884 2:106705909-106705931 TTGTAACAGGAGATGGAACATGG - Intergenic
935876919 2:107518179-107518201 TTAGAAAAGGAGAAGTAAAATGG - Intergenic
935932470 2:108142713-108142735 TTGTATATGGTGAAAGGAAAGGG - Intergenic
936237249 2:110753195-110753217 TGGTAGAAGTAGAAGGCAAAAGG - Intronic
936387197 2:112041035-112041057 TAGAATTAGGAGAAGGAAAATGG - Intergenic
936526887 2:113247361-113247383 TTCCATGAGGAGAAGGAGAAAGG - Intronic
936784306 2:116074877-116074899 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
936798140 2:116231927-116231949 TTGTATATGGTGAAAGAAAGGGG - Intergenic
936857195 2:116973058-116973080 TTGTATACGGTGAAAAAAAAGGG + Intergenic
937157766 2:119733195-119733217 TTTTAAATGGAGAAAGAAAAAGG - Intergenic
937195797 2:120155592-120155614 TTCTATAAGGAGAAGAGAAAGGG - Intronic
937716168 2:125036117-125036139 TTGTTTAAGGAGACTGAATATGG + Intergenic
938136389 2:128761360-128761382 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
938221615 2:129573766-129573788 TTGTATAAGGTATAGGGAAAGGG - Intergenic
938236406 2:129709945-129709967 TTGAAAAAGGAGAAGGTGAAAGG - Intergenic
938504462 2:131862656-131862678 TTTTAAAATGAGTAGGAAAATGG - Intergenic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
938980124 2:136518428-136518450 TTGTAGAAGGAAAGGAAAAAAGG - Intergenic
938996215 2:136681336-136681358 TTGTATAAGGTGTAAGAAAGTGG - Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939192669 2:138934280-138934302 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
939216786 2:139248891-139248913 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
939528537 2:143327577-143327599 TTGTATAAGGTGTAGGGAAGGGG - Intronic
939636705 2:144590956-144590978 TTTTAGAATGAGATGGAAAAAGG - Intergenic
939849098 2:147282665-147282687 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
939878896 2:147607781-147607803 GTGTATAAAGAGAATTAAAACGG - Intergenic
939904225 2:147890923-147890945 TTTCATAAGTAGAAAGAAAATGG - Intronic
940072704 2:149707054-149707076 TTGTGTAAGGAGAGAGATAAGGG - Intergenic
940086544 2:149865606-149865628 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
940114319 2:150191619-150191641 TTGAACAGAGAGAAGGAAAAGGG - Intergenic
940371012 2:152900839-152900861 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
940403377 2:153272085-153272107 TTGTATAAGGTGTAGAAAAGGGG - Intergenic
940504513 2:154535811-154535833 TTGAATAAAAAGAATGAAAAAGG + Intergenic
940531420 2:154882615-154882637 GAGTATAAAGAGAAGGAAAGGGG - Intergenic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
940727799 2:157354935-157354957 TGGTTTGTGGAGAAGGAAAAAGG - Intergenic
941092131 2:161189807-161189829 TTGTATATGGAGAAAGGCAAGGG - Intronic
941321494 2:164061034-164061056 GTGTATGAGGAGGAGAAAAAAGG + Intergenic
941415769 2:165219018-165219040 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
941420997 2:165282558-165282580 TTGTTTAAGTAGCAGGAAAAAGG - Intronic
941893357 2:170605314-170605336 ATGTAAAGGGAGAAGAAAAAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942372267 2:175297817-175297839 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
942566534 2:177269688-177269710 TTTTATAAGAAGAAGAAAAAAGG + Intronic
942580321 2:177410469-177410491 TAGAATTAGGAGAAGGAAAAAGG - Intronic
942616202 2:177794324-177794346 TTGTTTAAGGAAAAGCAAAGAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942816596 2:180060106-180060128 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
943100579 2:183481060-183481082 CTGTATAAGGTGTAGGAAAGGGG - Intergenic
943186532 2:184614252-184614274 TTGTATAAGGTGTAAGAAAGGGG - Intronic
943269667 2:185782950-185782972 ATAGATAAGGAGAAGGAGAAAGG - Intronic
943413847 2:187573515-187573537 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
943697918 2:190956294-190956316 TTGTATAAGGTGAAAGGAAGGGG + Intronic
943997436 2:194788112-194788134 TTGTATAAGGTGTAAGGAAATGG + Intergenic
944039237 2:195335876-195335898 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
944384021 2:199144103-199144125 TGGTAGAAGGTGAAGAAAAAGGG - Intergenic
944790259 2:203117640-203117662 TTAGATAAGTAAAAGGAAAAAGG + Intronic
944926487 2:204470467-204470489 TTGTAAAAGTAGATAGAAAAGGG + Intergenic
945042710 2:205755511-205755533 CTCTGTAGGGAGAAGGAAAATGG - Intronic
945381860 2:209149950-209149972 TTGGATAAGGAGAGGGAAAGTGG - Intergenic
945389442 2:209246302-209246324 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
945441406 2:209884518-209884540 TTGTATAAGGTGTAAGGAAAGGG - Intronic
945639375 2:212404262-212404284 TTGAAGAAAGAGGAGGAAAAAGG - Intronic
945734479 2:213581952-213581974 ATGTACAGGGAGAAGGAAAGAGG - Intronic
945787024 2:214253476-214253498 TTGTATAAGGTGTAAGAAACGGG + Intronic
945851257 2:215010446-215010468 TTATAAAGGGAGAAGCAAAATGG + Exonic
946450879 2:219778071-219778093 TTGTATCAGGAGAAAGGAATGGG + Intergenic
946589098 2:221223434-221223456 TTGTTTCAGGACAAAGAAAATGG - Intergenic
946592138 2:221262462-221262484 TTGCATAAGGGGAAGGATGAAGG - Intergenic
1168741070 20:191928-191950 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1169396593 20:5236928-5236950 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1170152684 20:13241906-13241928 ATATATAAGGAGAAGAGAAAGGG + Intronic
1170290051 20:14758987-14759009 TTGAAAAAGGAGATAGAAAAAGG - Intronic
1170332186 20:15225308-15225330 TTTTATAAGGACAGGGTAAATGG + Intronic
1172161528 20:32872158-32872180 TTGTATAAGGAGAATAGAATGGG + Intronic
1172183806 20:33019344-33019366 TTGAAGAAGGATAAGGGAAAGGG - Intronic
1173027065 20:39317864-39317886 ATGTATAAAGAGAGAGAAAATGG - Intergenic
1173215433 20:41077606-41077628 ATAAAGAAGGAGAAGGAAAATGG + Exonic
1173753049 20:45491820-45491842 TTGGAAAGGGGGAAGGAAAAAGG + Intergenic
1174977446 20:55350977-55350999 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1175041396 20:56054853-56054875 TTGTATAAGGAGTAAGGAAGGGG - Intergenic
1175056048 20:56199209-56199231 TGGCAAAAGGAGAAGGCAAAGGG + Intergenic
1175272056 20:57741110-57741132 AAGTATAAGGAGAAAGAAAGTGG + Intergenic
1175332418 20:58174727-58174749 TTCTTTCAGGAGAAAGAAAATGG + Intergenic
1175353449 20:58343208-58343230 TTGAACAAGGAGCAGGAAGATGG - Intronic
1175369145 20:58475529-58475551 TTTTATAAGGAGATGTACAAGGG + Intronic
1175432604 20:58916810-58916832 TTTAATGAGGAAAAGGAAAAAGG + Intergenic
1176792577 21:13336675-13336697 TTTTAAAATGAGTAGGAAAATGG + Intergenic
1176796586 21:13374656-13374678 TGGTAGATGGAGAAGGGAAAGGG + Intergenic
1177028291 21:15950320-15950342 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1177133180 21:17282027-17282049 TTTTATTAGCAGAATGAAAATGG + Intergenic
1177230155 21:18309225-18309247 TTGTATAAGGTGTAAGAAAGGGG - Intronic
1177269970 21:18834897-18834919 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1177381110 21:20345577-20345599 TTGTATAAGGTGTTGGAAAGGGG - Intergenic
1177550597 21:22615821-22615843 TTGTTTAAGGAGGAGGACACAGG + Intergenic
1178181568 21:30167966-30167988 ATGTAAAAGAAAAAGGAAAAGGG - Intergenic
1178228793 21:30756228-30756250 TAGTGAAAGGAGAAGAAAAATGG - Intergenic
1179173361 21:38990200-38990222 AAGTAGAAGGAGAAGGGAAAAGG + Intergenic
1179258809 21:39740488-39740510 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1179430992 21:41321087-41321109 TTGTATTTGGAGAAGGAAACTGG - Intronic
1181413412 22:22742035-22742057 TTGTATACGGAGAGAGACAAGGG - Intronic
1182014623 22:27029503-27029525 CTCTATGAGGAGGAGGAAAATGG - Intergenic
1183100543 22:35580982-35581004 TTGTAGCTGGAAAAGGAAAACGG + Intergenic
1183169540 22:36176475-36176497 TGGTATAAAAAGAAGGATAAGGG - Intergenic
1183792492 22:40084194-40084216 TTAAGTCAGGAGAAGGAAAATGG + Intronic
1183957306 22:41388645-41388667 ATGTAAAAGGAGGAGGAATAAGG - Intronic
1184898930 22:47431756-47431778 TGCTAGAAGGAGAAAGAAAAGGG + Intergenic
1184980226 22:48090411-48090433 TTGTAAAAGAAGAATGAGAATGG + Intergenic
949134502 3:546733-546755 TTGGACAAGAAGAAGGAAAGGGG + Intergenic
949215399 3:1561195-1561217 TTGTATTAGGACTAGGAAAAAGG + Intergenic
949696636 3:6704217-6704239 TTGTATACGGTGAAAGAAAGGGG - Intergenic
949881236 3:8662579-8662601 ATGAAAAAGGAGAAGGAACAAGG + Intronic
950561523 3:13731566-13731588 TTGTATAAGGTGTAAGAAAAAGG + Intergenic
951361258 3:21727140-21727162 TTGTATAAGGTGTAAGAAAGGGG - Intronic
951675999 3:25242478-25242500 TTGTATAAGGTGAAAGGAAGGGG + Intronic
951758883 3:26123145-26123167 TTGTATAAGGTGAATGCAAGGGG - Intergenic
951763638 3:26172425-26172447 CTGTATAAGCAGCATGAAAATGG + Intergenic
951939135 3:28058671-28058693 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
952078391 3:29727184-29727206 TTGTATAAGGTGTAAGAAAGGGG - Intronic
952285380 3:31963262-31963284 TTATATAAGGAGAAGGGGATGGG - Intronic
952721374 3:36536564-36536586 TTGTATAAGGTGTAAGAAAGGGG - Intronic
952921892 3:38291082-38291104 TAAAATTAGGAGAAGGAAAAAGG - Intronic
953264724 3:41375598-41375620 TTGTATAAGGTGTAGGGAAGGGG - Intronic
953441153 3:42918636-42918658 TAGAATAAGGATAAGGATAAGGG + Intronic
953712005 3:45281366-45281388 TTGTATATGGTGAGGGATAAGGG - Intergenic
953735459 3:45490433-45490455 TTCAATAAGTAGAAGGAGAATGG + Intronic
953764385 3:45725127-45725149 TTGCAAAAGGAGAAGGAAGTTGG - Intronic
953956449 3:47235538-47235560 TTGTAGAAGGAGATGGAATCAGG + Exonic
954402523 3:50326480-50326502 GTGTAGAGGGAGAAGGAAACAGG + Intronic
955648075 3:61162349-61162371 TCCTACCAGGAGAAGGAAAAAGG + Intronic
955886323 3:63602518-63602540 TTGTATATGGTGTAAGAAAAGGG + Intronic
955929997 3:64046830-64046852 TTCTATAAAGACAAGGGAAATGG - Intergenic
955955438 3:64284587-64284609 TTATTTAAGAAGAAGGAAAATGG - Intronic
956253158 3:67255367-67255389 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
956999953 3:74874060-74874082 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
957122006 3:76105795-76105817 TCCAATAAGGAGAAGGAATATGG + Intronic
957127019 3:76174535-76174557 TTGTATAAGGTGTAAGGAAAGGG + Intronic
957596166 3:82269568-82269590 TTGCATAAGGTGAAAGAAAGGGG + Intergenic
957629632 3:82702586-82702608 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
957697133 3:83653713-83653735 AAGTATAAGAATAAGGAAAATGG + Intergenic
957787612 3:84902149-84902171 CTTTATAAGCAGAATGAAAATGG + Intergenic
957809472 3:85200927-85200949 TTGTATTAAGAGAGTGAAAATGG - Intronic
957851521 3:85813711-85813733 TTGTATAAGGTGTAGGGAAGGGG + Intronic
958002906 3:87773756-87773778 TTGTATAAGGTGAGAGAAGAGGG + Intergenic
958177005 3:90008713-90008735 TTGGAGAAGGAGATGGAAATTGG - Intergenic
958421149 3:93933163-93933185 TTGGATGAGGTGAAGGAAAATGG + Intronic
958455558 3:94326842-94326864 TGGTCTCAGGAGAAGAAAAATGG + Intergenic
958637254 3:96761328-96761350 TCGTATAAATAAAAGGAAAATGG - Intergenic
958642048 3:96816089-96816111 TTGTGTGAGGAGAAGGTTAAGGG + Intronic
958717979 3:97809789-97809811 TTATAGAAGGAAAAGGAAGAAGG + Intergenic
958815539 3:98910567-98910589 TTGTATATGGTGTAAGAAAAGGG - Intergenic
959417925 3:106099703-106099725 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
959418554 3:106105809-106105831 ATATCTAAGGAGAAGGAAAAGGG - Intergenic
959481507 3:106878310-106878332 TTGTATATGGTGAAAGAAAAGGG + Intergenic
959751256 3:109838474-109838496 TTGTAGAAGGAGCAGTATAAGGG + Intergenic
959769443 3:110074849-110074871 TTGAAGAAGGATAAGGAAATGGG - Intergenic
959828555 3:110832015-110832037 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
959834182 3:110898970-110898992 TTGTATAAGGAGTAAGGAAGGGG - Intergenic
959846890 3:111043206-111043228 TTATATAAGGAGAGAGACAAAGG - Intergenic
959987605 3:112593295-112593317 GTGGATGGGGAGAAGGAAAAGGG + Intergenic
960018403 3:112919334-112919356 TTGTATAAGGTGTAGGAAAGGGG - Intergenic
960453895 3:117845657-117845679 AGGCATAGGGAGAAGGAAAAGGG - Intergenic
960520737 3:118652066-118652088 TTGTCAAAGCAGAGGGAAAAGGG + Intergenic
960535953 3:118814593-118814615 TTGTATAAGAAGACTGAATATGG + Intergenic
960757259 3:121029499-121029521 TTGTATAAGGTGTAAGGAAAGGG - Intronic
960761865 3:121080623-121080645 TTGTTTAAGGAGGTGGAAGATGG + Intronic
960815607 3:121668776-121668798 TAGGATACGGAGGAGGAAAAGGG - Intronic
961153192 3:124657166-124657188 TTGGATTGGGAGAAGGAAGAGGG + Intronic
961311037 3:126001485-126001507 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
961960446 3:130849007-130849029 TTTTAAAAAGAGAAGCAAAAGGG + Intergenic
962059294 3:131908258-131908280 TTGTAAAAATAGAAGGAAAATGG - Intronic
962100588 3:132338172-132338194 TTGTATATGCATAAGGAAATTGG - Intronic
962495781 3:135937657-135937679 TAGAATTAAGAGAAGGAAAAAGG + Intergenic
962689940 3:137885162-137885184 TTGTATAAGGTGTAAGAAATGGG + Intergenic
962766219 3:138565657-138565679 TTGTATAAGGTGTAAGAAAGGGG - Intronic
962966545 3:140359466-140359488 TTAAGAAAGGAGAAGGAAAAAGG + Intronic
963188291 3:142442095-142442117 TAGAATTAGGAGAAGGAAAAAGG + Intronic
963284342 3:143418484-143418506 TTGTAACAGGAGAAGGAGATGGG + Intronic
963809150 3:149757695-149757717 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
963916090 3:150860092-150860114 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
964458464 3:156894861-156894883 TTGTATATGGTGAAAGCAAAGGG - Intronic
964734383 3:159901255-159901277 TGGTACAAGGAGAAAGAGAATGG - Intergenic
964759472 3:160120864-160120886 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
964886321 3:161487398-161487420 GAATATCAGGAGAAGGAAAATGG - Intergenic
964963944 3:162465793-162465815 TTGTATATGGTGTAAGAAAAGGG - Intergenic
965013160 3:163123532-163123554 CTACATAAGCAGAAGGAAAAGGG - Intergenic
965054470 3:163696144-163696166 TAGAATTAGGAGAAGGAAAGAGG - Intergenic
965110771 3:164418672-164418694 TTGTATAAGGATGAGCAAACAGG + Intergenic
965249508 3:166324927-166324949 TTGTATACGGTGAAATAAAAGGG + Intergenic
965268511 3:166581665-166581687 TTGTATAACAAGAAAGAAATAGG - Intergenic
965511396 3:169571808-169571830 TTGTATAAGGTGTAAGAAAGGGG - Intronic
965545833 3:169915501-169915523 AGGAAAAAGGAGAAGGAAAAAGG - Intronic
965825269 3:172723294-172723316 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
965926621 3:173988254-173988276 TTATATAAAGACAAGTAAAATGG - Intronic
966070493 3:175871512-175871534 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
966173788 3:177113185-177113207 TTGTATATGGTGAAAGATAAGGG - Intronic
966353891 3:179058902-179058924 TAGAATTAGGAGAAGGAAAAAGG + Intronic
966679300 3:182624238-182624260 TGGGATAAGGAGAAGGATTACGG - Intergenic
966705204 3:182906217-182906239 TTTCAAAAGGAGAAGTAAAAAGG - Intronic
967476729 3:189929993-189930015 TTGTGAAAGGAGAAGTAAAGGGG - Intergenic
967623878 3:191664339-191664361 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
968391065 4:193451-193473 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
968450358 4:673239-673261 TTGTGCAGGGATAAGGAAAATGG - Intronic
969645292 4:8424979-8425001 TAAAATTAGGAGAAGGAAAAAGG + Intronic
970110100 4:12628235-12628257 TAGTAAAGGGAGAAGGAAAAAGG - Intergenic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
970680274 4:18499151-18499173 TTGTATAAGGTGTAGGGAAGGGG - Intergenic
970705405 4:18795573-18795595 TTTTATAAGGAGAAGAAGAGAGG - Intergenic
970815056 4:20145351-20145373 TTGTATAAGGTGAAAGGAAGGGG - Intergenic
970954051 4:21789963-21789985 ATGTATATGAAGATGGAAAATGG - Intronic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971446712 4:26758139-26758161 TTTTATAAGAACAAGGAGAAGGG - Intergenic
971557010 4:28025566-28025588 TTCTAGAGGGAGAATGAAAAAGG - Intergenic
971853491 4:32013710-32013732 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
972179176 4:36442919-36442941 TAGAATTAGGAGAAAGAAAAAGG - Intergenic
972781025 4:42287039-42287061 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
972794327 4:42400225-42400247 TTGTAGAGAGAGAAGGAAATTGG + Intronic
972948202 4:44284440-44284462 TTGTATAAGGTGTAAGAAAGGGG - Intronic
973033459 4:45373637-45373659 TAGTAGAAGGAGAAAGAAACTGG - Intergenic
973138458 4:46735642-46735664 TTAAAGAAGGAGAAGGAAAGGGG - Intronic
973920902 4:55683835-55683857 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
974503631 4:62738354-62738376 TTGTATAAGGTGTAGGGAAGGGG - Intergenic
974533801 4:63148413-63148435 ACGGAGAAGGAGAAGGAAAAAGG - Intergenic
974660279 4:64879513-64879535 TTTTATAAAGAGAAGGTGAAGGG - Intergenic
974942285 4:68483805-68483827 TTGTATATGGTGAAAGAAAGGGG + Intronic
974955945 4:68641408-68641430 TTGTATAAGGTGTAAGAAAGGGG + Intronic
974999903 4:69210581-69210603 GTGTAAAAGGACAAGAAAAAAGG - Intronic
975005870 4:69284628-69284650 GTGTAAAAGGACAAGAAAAAAGG + Intronic
975014284 4:69393580-69393602 GTGTAAAAGGACAAGAAAAAAGG + Intronic
975015537 4:69412967-69412989 ATGTAGAAGGACAAGAAAAAAGG + Intronic
975508486 4:75166127-75166149 TTGTATAAGGTGAAAGGAAAGGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975807007 4:78123149-78123171 TTGTATAAGGTGTAAGGAAAGGG + Intronic
976011814 4:80498063-80498085 TTGTATATGGTGAAGGGAAGGGG - Intronic
976339919 4:83935437-83935459 TTGAATCAGCAGAAGGACAAAGG - Intergenic
976464623 4:85353355-85353377 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
976530900 4:86150883-86150905 TTGTAAAATGAGAACTAAAAAGG + Intronic
976533881 4:86188925-86188947 TTGTATAAGGTGTAAGGAAAGGG + Intronic
976681137 4:87757427-87757449 GAGTGTGAGGAGAAGGAAAAGGG + Intergenic
976769870 4:88639555-88639577 TTGTATAAGGTGTAGGGAAGGGG - Intronic
976796609 4:88940792-88940814 TTGTAGCATGAGATGGAAAAGGG + Intronic
977065853 4:92314025-92314047 TTATATAAGTTGAAAGAAAAAGG - Intronic
977153410 4:93542810-93542832 TTTTACCAGAAGAAGGAAAATGG - Intronic
977207075 4:94175371-94175393 GTGTTTAAAGAGTAGGAAAAGGG - Intergenic
977221745 4:94345500-94345522 TGGAATAGGGAGGAGGAAAAGGG + Intergenic
977277084 4:94991164-94991186 CAGTAGAAGGAGAATGAAAAAGG - Intronic
977617532 4:99102968-99102990 AGGTACAAGGATAAGGAAAATGG + Intergenic
977617904 4:99105995-99106017 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
977845841 4:101765732-101765754 TTGTATATGGTGAAAGATAAGGG + Intronic
977918971 4:102623370-102623392 TTGCTTTAGGAAAAGGAAAAAGG - Intergenic
977922879 4:102665118-102665140 TTTTAGAAAGAGAAAGAAAAGGG + Intronic
978147237 4:105390129-105390151 TTGTATAAGGTGTAGGGAAGGGG - Intronic
978586465 4:110280433-110280455 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978721534 4:111915888-111915910 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
978909890 4:114050573-114050595 TAGAATTAGGATAAGGAAAAAGG + Intergenic
979124709 4:116954304-116954326 CTGTCTATGGAGAAGTAAAATGG - Intergenic
979435136 4:120679294-120679316 TTGTATAAGGTGAAAGATGAAGG - Intergenic
979689869 4:123548502-123548524 TTGTCTAAGGAGAAATTAAATGG - Intergenic
979697854 4:123634442-123634464 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
979810298 4:125028422-125028444 TTTTATTAGCAGCAGGAAAATGG - Intergenic
979828364 4:125268631-125268653 TTGTATATGGCGAAAGAAATGGG - Intergenic
979863022 4:125717990-125718012 TTGTATAAGGAGTAAGATAAAGG - Intergenic
979875676 4:125887927-125887949 TTGTAAGAAGTGAAGGAAAAGGG - Intergenic
979879834 4:125941602-125941624 TTGAAAAATGAGAAGGCAAATGG + Intergenic
980113633 4:128658688-128658710 TAGAACAGGGAGAAGGAAAAGGG + Intergenic
980174802 4:129331749-129331771 TTGTAAAATGAGAATGATAATGG - Intergenic
980185093 4:129451028-129451050 TTGTATAAGGTGTAAGAAAGAGG - Intergenic
980398939 4:132254441-132254463 TTGTATATGGTGAAAGAAAGAGG + Intergenic
980444553 4:132887889-132887911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
981084319 4:140667408-140667430 TTGAACAAGGAGGATGAAAATGG + Intronic
981149116 4:141360995-141361017 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG + Intronic
981626525 4:146762644-146762666 TTTTAGAAGGAGGAGAAAAAGGG - Intronic
981655212 4:147105086-147105108 CTGTAAAAGGAGAAGGGTAAGGG - Intergenic
981665696 4:147223646-147223668 TTGTTTAAGGATAAATAAAACGG - Intergenic
981681486 4:147404472-147404494 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
981737222 4:147965519-147965541 TTTTAAAAGGAGGAGGAAAAGGG - Intronic
982097455 4:151935791-151935813 TTGTAGATGGAGAAGGGAAAGGG + Intergenic
982344692 4:154344644-154344666 TTGCAGAAACAGAAGGAAAAAGG + Intronic
982450833 4:155550658-155550680 TTGTTTAAAGAGAAAAAAAAAGG - Intergenic
982844092 4:160227487-160227509 TTGAAGAAGGAGAAGAAAAGAGG + Intergenic
982901263 4:161005584-161005606 TGGTATAATTAGGAGGAAAAAGG + Intergenic
983231982 4:165138098-165138120 TTGTAGAAGGAGAGGGAAACAGG + Intronic
983329487 4:166306393-166306415 TTGTATAAGGTGAAAGAAGGGGG - Intergenic
983424540 4:167566554-167566576 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
983493457 4:168416253-168416275 TTGGATAAGGACAAAGAAAGGGG + Intronic
983662945 4:170148911-170148933 TTGTATATGGTGAAAGATAAGGG + Intergenic
983666700 4:170191450-170191472 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
983750336 4:171260433-171260455 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
983895764 4:173079982-173080004 TTGTATAAGGTGGAAGGAAAGGG + Intergenic
983963354 4:173780793-173780815 ATGTATAAGGAAAAGAAATATGG + Intergenic
983983385 4:174027030-174027052 TTGTAAAATGAGAAAGAAAATGG - Intergenic
983990322 4:174110856-174110878 CTGTATAATAAGAATGAAAAAGG - Intergenic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
984076326 4:175185457-175185479 TTGTATATGGAGAAAGACAGGGG + Intergenic
984300995 4:177917530-177917552 TTGTATAAGGTGTAAGAAAGGGG + Intronic
984724064 4:183003154-183003176 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
984990270 4:185373683-185373705 TCCTATAAGGAGAAGGAAATGGG - Intronic
985204976 4:187525702-187525724 TTGTATAAGGGGTAAGGAAAGGG - Intergenic
985981271 5:3467038-3467060 TTATTTAAGCAGAAGAAAAATGG + Intergenic
986964390 5:13253002-13253024 ATGTATCTGGAGAAGGAAAGAGG + Intergenic
986999272 5:13642769-13642791 TGGTATAAGAAGAAGTATAATGG + Intergenic
987394633 5:17410882-17410904 TTATATATGGAGAGAGAAAAGGG - Intergenic
987540231 5:19245555-19245577 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
987967059 5:24891052-24891074 TTATAGAAGTAGAAGCAAAATGG - Intergenic
988435534 5:31170190-31170212 TTGTTTAAGGAGAAGTTAAAAGG - Intergenic
988456978 5:31395302-31395324 TAGAATTGGGAGAAGGAAAAAGG - Intergenic
988557043 5:32246030-32246052 TTGTAACAGGAGAAGAAACATGG - Intronic
988613534 5:32751260-32751282 TTGTAAAATGAGAGAGAAAAAGG + Intronic
988618680 5:32800133-32800155 TTGTATAAGGTGTATGGAAAGGG - Intergenic
988884955 5:35546634-35546656 ATTTAAAAGGAAAAGGAAAAAGG - Intergenic
988956980 5:36329923-36329945 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
989189942 5:38660862-38660884 TTAAATAAAGAAAAGGAAAAGGG + Intergenic
989316151 5:40081443-40081465 TTGTGAAGGGAGAAGAAAAATGG + Intergenic
989348926 5:40461958-40461980 TTGTATATGGTGAAGGATAGAGG - Intergenic
989484435 5:41972889-41972911 TTGTATATGGTGAAAGAAAGGGG - Intergenic
990035822 5:51318299-51318321 TTATTCAAAGAGAAGGAAAATGG - Intergenic
990174050 5:53087380-53087402 TTGTGTAAGCAGGAGGAGAAAGG - Intronic
990192942 5:53280865-53280887 TTGTATAAGGTGTAAGAAAAGGG + Intergenic
990217441 5:53549829-53549851 GTATGTAAGGAGAAAGAAAAAGG + Intergenic
991274398 5:64827192-64827214 TTCTCTAATGAGTAGGAAAATGG + Intronic
991422895 5:66459475-66459497 TTGTATAAAGAGAGGCAAAGAGG - Intergenic
991574139 5:68085094-68085116 TTTTATATGGAAAAGGAAAGAGG + Intergenic
991748249 5:69769177-69769199 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991799829 5:70349022-70349044 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991828768 5:70661016-70661038 CTTAAAAAGGAGAAGGAAAAAGG + Intergenic
991892187 5:71348453-71348475 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
992456102 5:76917160-76917182 TTGTATGAAAAGAAGAAAAAAGG + Intronic
992563606 5:77976004-77976026 TTGTAGAGTGAGAGGGAAAAAGG + Intergenic
992864790 5:80947041-80947063 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
992961574 5:81960902-81960924 TTCTATGAAGAGAAGGAAAAAGG - Intergenic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
993265924 5:85726267-85726289 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
994045460 5:95304415-95304437 GTGTAGAAGGAAAATGAAAAAGG + Intergenic
994078003 5:95674775-95674797 TTGTTGAAGGAGAAGAAAATGGG - Intronic
994231826 5:97316333-97316355 TTCTGTAAGGGGAAGGCAAATGG - Intergenic
994242899 5:97445067-97445089 TTGTATATGGTGTAAGAAAAGGG - Intergenic
994384803 5:99118605-99118627 TTGTAATAGGAAAAGGAACATGG + Intergenic
994960327 5:106593795-106593817 TTGTATAAGGTGTAAGAAAGTGG - Intergenic
995093478 5:108208484-108208506 TTGTATAAGGTGTAAGCAAAGGG + Intronic
995126134 5:108578379-108578401 TAGAATTAGGAAAAGGAAAAAGG - Intergenic
995262814 5:110125083-110125105 TTGTATAAGGTGTAAGAAAAGGG + Intergenic
995268003 5:110187291-110187313 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG + Intronic
995464854 5:112440938-112440960 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
995465968 5:112449799-112449821 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
995621053 5:114026199-114026221 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
995805708 5:116050097-116050119 TTTTATAAGGAGAAATAACAAGG + Intronic
995988854 5:118210935-118210957 TTGTTTAAAGAGTATGAAAATGG + Intergenic
996109154 5:119544274-119544296 TTGTATAAGGTGTAAGAAAGGGG + Intronic
996109672 5:119550433-119550455 AAGCAAAAGGAGAAGGAAAAAGG + Intronic
996244880 5:121249737-121249759 TTGTATAAGGTGTAAGGAAATGG + Intergenic
996293547 5:121884124-121884146 TTGTATATGGTGAAAGATAACGG - Intergenic
996883004 5:128322457-128322479 TCGTATAAGGGGAAAGAAAGGGG + Intronic
996971356 5:129372202-129372224 TGGAATAAAGAGAAGGGAAATGG + Intergenic
997621020 5:135295368-135295390 TAATATAAGCAGAAGGAATAGGG - Intronic
998554822 5:143113228-143113250 TTGTTTAGAGAAAAGGAAAAAGG - Intronic
998566092 5:143217167-143217189 ATGAATAAGGAAGAGGAAAAGGG + Intronic
998601998 5:143593973-143593995 TTGTAAAAGGAGAAAAAGAACGG + Intergenic
998645678 5:144059178-144059200 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
998774530 5:145584257-145584279 TTGTATAAGGTGTAAGAAAGGGG - Intronic
998789907 5:145755078-145755100 TTGTACAAGGAGATGAAACATGG + Intronic
999967925 5:156829832-156829854 TTGTATAATTAGAAGAAAAAGGG - Intergenic
1000134413 5:158332516-158332538 TTGTATATGGTGAAAGAAGAGGG + Intergenic
1000584342 5:163078169-163078191 TTGTATAAGGTGAAAGGAAGGGG - Intergenic
1002059795 5:176619624-176619646 TTGTCTAAGGGGAAGGGAAATGG - Intergenic
1002557077 5:180050621-180050643 TAGAATAAGGAGGAGGGAAATGG - Intronic
1002832169 6:832266-832288 TTGTATAAGGTGTAAGAAAGTGG - Intergenic
1003082078 6:3028827-3028849 TTTTCTACCGAGAAGGAAAAAGG - Intergenic
1003249206 6:4410703-4410725 TTGTATAAGGTGTAAGAAAGAGG - Intergenic
1003277627 6:4665951-4665973 GAATATAAGGAGAACGAAAAGGG - Intergenic
1003317799 6:5027571-5027593 TTTTATCAGCAGAAAGAAAAAGG - Intergenic
1004593716 6:17078719-17078741 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1005092946 6:22078398-22078420 TTGTATTAGGAGAAGCATGATGG - Intergenic
1005323330 6:24676975-24676997 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1005555496 6:26977209-26977231 TTTTAAAAGGAGAAGAAATATGG - Intergenic
1005558593 6:27013376-27013398 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1006324019 6:33339659-33339681 TTGTATAATCAGACTGAAAATGG + Intergenic
1006994285 6:38243872-38243894 TTAAAAAAGAAGAAGGAAAAGGG - Intronic
1007263536 6:40580577-40580599 TTGTATATGGATGAGGAAACTGG - Intronic
1007957454 6:45930318-45930340 TTGTAGAAGGAGAAGAGGAAAGG + Intronic
1007987354 6:46220247-46220269 GGGTATTAGGAGAATGAAAAGGG - Intergenic
1008003484 6:46385516-46385538 TTGTATAAGGTGTAAGAAAAGGG - Intronic
1008155734 6:48011745-48011767 TTGTATAAGGTGTAAGGAAAGGG + Intronic
1008811300 6:55503531-55503553 GTGTGTAATGAGAATGAAAAAGG + Intronic
1009244734 6:61222685-61222707 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1009454909 6:63845032-63845054 TTGTATAAGGTGTAAGGAAAGGG + Intronic
1009545115 6:65010716-65010738 TAAAATTAGGAGAAGGAAAAAGG + Intronic
1009577759 6:65488945-65488967 TTGTATAAGGAGTAAGGAAGGGG - Intronic
1009599267 6:65777007-65777029 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1009706732 6:67261741-67261763 TTGTATAAGGTGTAAGAAACGGG + Intergenic
1009709183 6:67295841-67295863 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1009733424 6:67640770-67640792 TTTTATAAGATGAAAGAAAATGG - Intergenic
1009794614 6:68451426-68451448 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1009916308 6:70001041-70001063 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1010012353 6:71063207-71063229 TTGTATATGGTGAAAGATAAGGG + Intergenic
1010423608 6:75701978-75702000 TTACATAAAGAGAAGGCAAAGGG + Intronic
1010650814 6:78453629-78453651 TTGTATAGGGAGACTGACAAGGG - Intergenic
1010681344 6:78802767-78802789 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1010684648 6:78839076-78839098 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1010882235 6:81192067-81192089 TTTCATAAGGAGATGTAAAATGG - Intergenic
1010893788 6:81342933-81342955 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1010915001 6:81604889-81604911 TTGTATAAGGTGTAAGGAAAGGG - Intronic
1011077110 6:83449153-83449175 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1011189452 6:84714481-84714503 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1011199416 6:84818745-84818767 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1011344951 6:86358848-86358870 TTGGAAATAGAGAAGGAAAAGGG + Intergenic
1011393649 6:86882105-86882127 TTGTATAAGGAGTAAGGAAGGGG + Intergenic
1011396474 6:86914973-86914995 TTTTTTTAGGAGTAGGAAAAAGG - Intergenic
1011425808 6:87228601-87228623 TTGTATATGGTGCAGGAATAGGG + Intronic
1011482246 6:87806580-87806602 TTGTTAAAAGAGAAGGAACAGGG + Intergenic
1011539526 6:88415412-88415434 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1012070081 6:94603653-94603675 TTGTATCAGTAGCATGAAAATGG - Intergenic
1012096640 6:94970862-94970884 GTGTATGTGGAGAAGGAAGAGGG + Intergenic
1012292002 6:97468271-97468293 TAGTATAAGAAGAAATAAAAGGG + Intergenic
1012728034 6:102841760-102841782 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1012745195 6:103078107-103078129 CTGTCAAAGGAGATGGAAAATGG - Intergenic
1013379445 6:109552877-109552899 TTGTATAAGGTGTAAGGAAAGGG + Intronic
1013433257 6:110075257-110075279 TTTTTTAAGGAGAATGAAAAGGG + Intergenic
1013543880 6:111136848-111136870 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1013930165 6:115521061-115521083 TTGTATAAGGTGAAAGGAAGGGG - Intergenic
1014070821 6:117179806-117179828 TTGTATAAGGTGTAGGGAAGGGG - Intergenic
1014256762 6:119168414-119168436 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1014754089 6:125284131-125284153 TTGTATAAGGTGTAAGGAAAGGG - Intronic
1014836080 6:126162233-126162255 TTGTATAAGGTGTAAGTAAAGGG + Intergenic
1014841157 6:126221983-126222005 TTGTAAAAGGCGAAAGGAAAGGG + Intergenic
1014856536 6:126408571-126408593 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1015147134 6:129999888-129999910 TTGTATCTTCAGAAGGAAAAGGG + Intergenic
1015211763 6:130706578-130706600 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1015291596 6:131543856-131543878 TTGTATAAGGTGTAAGAAAAGGG - Intergenic
1015327172 6:131936266-131936288 TTTTATAAGGAGAAGTAAATAGG - Intergenic
1015537241 6:134278949-134278971 GTGTAAATGGAGAAGGAAAAAGG + Intronic
1015666654 6:135638056-135638078 CTGGATAAGGTGATGGAAAATGG + Intergenic
1015837048 6:137431699-137431721 TTGCAAAAGGAGAAGGAATAGGG + Intergenic
1015865159 6:137720170-137720192 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1016140096 6:140597856-140597878 TTGTATAAGATGTAAGAAAAGGG + Intergenic
1016241481 6:141936475-141936497 ATGTATAAGGTAAATGAAAACGG - Intergenic
1016444375 6:144117555-144117577 TAGAATTAGGGGAAGGAAAAAGG - Intergenic
1016542485 6:145181273-145181295 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1016731633 6:147433545-147433567 TTATATAAGCAGAAAGAATATGG - Intergenic
1016810718 6:148258777-148258799 ATGTATAAGGGGAATGAAAGAGG - Intergenic
1016895535 6:149048241-149048263 TTATACAAGGAGAAAGTAAAGGG + Intronic
1017272396 6:152523226-152523248 TTGTATAAGGCGAGGGATAGGGG + Intronic
1017284012 6:152653703-152653725 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1017359879 6:153555353-153555375 TTGGAGAAGGAAAAGGAAACTGG - Intergenic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1017448710 6:154533136-154533158 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1017732058 6:157325337-157325359 ATGTATGAGGGGAAGGAAAAAGG - Intergenic
1017836053 6:158179018-158179040 TTGTATAAGGTGTAAGGAAAGGG + Intronic
1017987075 6:159453366-159453388 TTGTATAAGGTGCAAGGAAAGGG - Intergenic
1018136409 6:160782107-160782129 CTTTATCAGGAGAATGAAAACGG + Intergenic
1018144218 6:160867809-160867831 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1018272127 6:162091730-162091752 TTTTATCAGTAGAAAGAAAAAGG + Intronic
1018761380 6:166897005-166897027 TAGAATTGGGAGAAGGAAAAAGG + Intronic
1020462691 7:8442561-8442583 TTGTAGAAGACGAAGGAAAATGG - Intronic
1020508197 7:9019651-9019673 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1020526129 7:9261087-9261109 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1021029803 7:15717569-15717591 TTATCAAAGGAGAAGGCAAAGGG + Intergenic
1021066754 7:16185074-16185096 TTTTATCAGCAGAATGAAAATGG - Intronic
1021138451 7:16993944-16993966 TTGGAGAAGGAGAAGAACAATGG - Intergenic
1021148138 7:17114785-17114807 TTGTATAAGGTGTAGGGAAGGGG + Intergenic
1021429238 7:20540778-20540800 TTGTATAAGGTGTAAGGAAAAGG - Intergenic
1021454354 7:20813280-20813302 TTGTATAAACAGGAGGAATATGG + Intergenic
1021464656 7:20928614-20928636 TTGTAGAAGGAGCAGTGAAATGG + Intergenic
1021465512 7:20938617-20938639 ATATACAAAGAGAAGGAAAAAGG + Intergenic
1021746189 7:23743539-23743561 TTCTAAAAACAGAAGGAAAAAGG - Intronic
1021917215 7:25445691-25445713 TTGTATTAGGAAAAAAAAAATGG - Intergenic
1022806688 7:33829585-33829607 TCCTAGATGGAGAAGGAAAAAGG - Intergenic
1023370276 7:39506124-39506146 TTGGAGACGGGGAAGGAAAAGGG - Intergenic
1023439194 7:40169141-40169163 TATAATTAGGAGAAGGAAAAAGG - Intronic
1024138919 7:46441611-46441633 TTGTATAAGGTGTAAGAAAAGGG + Intergenic
1024516570 7:50264420-50264442 TTATATAAGGTAAAGTAAAATGG + Intergenic
1024527498 7:50361172-50361194 CTTTAAAAGGAGAAGGGAAAGGG - Intronic
1024655429 7:51447861-51447883 TAGAATAAGGATAAGGACAAAGG - Intergenic
1024684029 7:51725595-51725617 TGGTATAAGGAGAACAAAAGAGG - Intergenic
1024762226 7:52612435-52612457 TTGTATAAGAAGAGGGAATGAGG - Intergenic
1024846728 7:53653150-53653172 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1025621293 7:63173839-63173861 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1025677275 7:63653298-63653320 ATTTACAAGGAGAAGGAAAGAGG + Intergenic
1026058167 7:67003286-67003308 TTGTATAAAAAGAAGTCAAAAGG - Intronic
1026658078 7:72274903-72274925 TTGTGTAAAGAGAAGAAATAGGG + Intronic
1026719922 7:72821726-72821748 TTGTATAAAAAGAAGTCAAAAGG + Intronic
1027357509 7:77372654-77372676 TTGTATAAGTAAAAGGTAAACGG + Intronic
1027551532 7:79603036-79603058 TTGTGAAAGGAGATGGAAATTGG - Intergenic
1027593976 7:80149880-80149902 TTGTTAAATGAGAAGAAAAAAGG + Intronic
1027693568 7:81379548-81379570 TTCTATAAATAGAAAGAAAAGGG + Intergenic
1027719058 7:81715233-81715255 TGGTGTAGGAAGAAGGAAAAAGG - Intronic
1027739105 7:81977559-81977581 TTGTATAAGGTGTAGGCAAGGGG - Intronic
1028083391 7:86604654-86604676 TTGTATATGGAGTAAGAAAGAGG - Intergenic
1028083543 7:86606292-86606314 TTCTATAAGGAGTAGAAAAATGG - Intergenic
1028144759 7:87309372-87309394 TTGTATAAGGTGTAAGGAAAAGG - Intergenic
1028301996 7:89211537-89211559 TTGTATAAGGTGAAAGGAAGGGG + Intronic
1028588247 7:92471887-92471909 TAGAATTAGGAGAAGAAAAAAGG - Intronic
1028667794 7:93366837-93366859 TTGTATGGGGAGAAGGATAAAGG - Intergenic
1028962574 7:96765912-96765934 TTGTATAAACAAAAGAAAAAAGG - Intergenic
1029187135 7:98747256-98747278 TTGCACAATGAGAAGGAACAAGG - Intergenic
1029644012 7:101840330-101840352 TGGTAGAAAGAGAAAGAAAAGGG - Intronic
1029844693 7:103400740-103400762 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1030333143 7:108294640-108294662 TTGTGCAATGGGAAGGAAAATGG + Intronic
1030715769 7:112805154-112805176 TTGGATAAGCAGGAGGAAAGGGG - Intergenic
1030843170 7:114380318-114380340 TAGAATTAGGAGAAGGAAAATGG - Intronic
1030880877 7:114877532-114877554 TTGTATAAGGTGAGAGATAAAGG + Intergenic
1031264893 7:119569589-119569611 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
1031319052 7:120298740-120298762 TTGCATGAGTAGAAGAAAAATGG - Intronic
1031471640 7:122174758-122174780 TAGAATTAGGAGAAAGAAAAAGG + Intergenic
1031533801 7:122909572-122909594 TTTTATAAGGTGAAGCAAACTGG + Intergenic
1031644448 7:124206561-124206583 ATGTATACAGAGAAGGAACAAGG - Intergenic
1032133390 7:129250485-129250507 TTGGACAAGAAGAAGTAAAATGG - Intronic
1032276992 7:130466496-130466518 TTTAATATGTAGAAGGAAAACGG - Intergenic
1032295448 7:130633892-130633914 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1032425987 7:131822511-131822533 TAGAATTAGGAAAAGGAAAAAGG - Intergenic
1032540352 7:132697707-132697729 ATGTGCAAGGAGAAGGGAAAGGG + Intronic
1032644346 7:133805816-133805838 TTTTATAAGTTGAAGGAAGAAGG + Intronic
1032725941 7:134590205-134590227 TAGAATTAGGAGAAGAAAAAAGG + Intergenic
1033287258 7:140052078-140052100 TTGTAACAGGAGATGGAACATGG - Intronic
1033491812 7:141851759-141851781 TTGTATATGGTGAAGGGAAGGGG - Intergenic
1033705259 7:143880499-143880521 TTGTATAAAGACAGAGAAAATGG - Intronic
1033854350 7:145539841-145539863 ATGCATATGGAGAAAGAAAAAGG + Intergenic
1034071868 7:148193910-148193932 TTGAACAAGCAGAAGGAAACGGG - Intronic
1034873209 7:154701855-154701877 TTGTATAAGGTGATGGCAGATGG - Intronic
1035582990 8:751983-752005 TTCTTTAAGGAGAAAAAAAATGG - Intergenic
1036474318 8:9079365-9079387 TTGTTTAGGGAAAATGAAAACGG - Intronic
1036483929 8:9162850-9162872 TTTTATCAGCAGAATGAAAACGG - Intronic
1037230137 8:16648424-16648446 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1037600718 8:20391601-20391623 TGGCATATGGATAAGGAAAAAGG + Intergenic
1037626206 8:20609263-20609285 TTTGAGAAGGTGAAGGAAAATGG + Intergenic
1037664990 8:20961181-20961203 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1038099705 8:24359607-24359629 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1038197264 8:25379814-25379836 TTGTTTGTGGAGATGGAAAAAGG - Intronic
1038242886 8:25826360-25826382 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1038859478 8:31371334-31371356 TTGTATATGGTGTAGGGAAAGGG + Intergenic
1039125119 8:34192422-34192444 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1039179088 8:34843814-34843836 TTGTGTAAGGAGAATGAGAAGGG + Intergenic
1039302853 8:36228695-36228717 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1040527421 8:48237168-48237190 TAGAATTAGGAGAATGAAAATGG - Intergenic
1041000901 8:53451791-53451813 TTGAAAAATGGGAAGGAAAAAGG + Intergenic
1041001160 8:53455348-53455370 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1041056147 8:53988580-53988602 TGGTATAAGGAGAGGGATGAAGG + Intronic
1041298806 8:56389637-56389659 TTGTAAAATGAGAGTGAAAATGG + Intergenic
1041663538 8:60421524-60421546 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1041749970 8:61250090-61250112 TTGTATAAGGTGTAAGGAAAGGG + Intronic
1041861870 8:62523616-62523638 TAGGAGCAGGAGAAGGAAAATGG + Intronic
1042032584 8:64492648-64492670 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1042056222 8:64767116-64767138 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1042111392 8:65384983-65385005 TTGTATAAGGTGTAAGAAAGCGG - Intergenic
1042323269 8:67501006-67501028 TTGAAAAAGAAGAATGAAAAGGG - Intronic
1042364602 8:67922384-67922406 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1042482428 8:69319314-69319336 TAGAAGAGGGAGAAGGAAAAGGG - Intergenic
1042730905 8:71933942-71933964 TGGTATAAGAAGAAGGGGAAGGG - Intronic
1042808480 8:72798008-72798030 TTGTATATGAAGAAGGGAAATGG - Intronic
1042812437 8:72841076-72841098 TTGTATAAGGTGTAAGGAAAGGG + Intronic
1042885935 8:73551765-73551787 TTAAAAAAGAAGAAGGAAAATGG + Intronic
1043032833 8:75159492-75159514 TTGTATACGGTGAAAGATAAGGG + Intergenic
1043128989 8:76437594-76437616 TTGTATAAGGTATAAGAAAAGGG + Intergenic
1043137472 8:76546527-76546549 CTGTAAAAGGAGCAGGAACAGGG - Intergenic
1043223426 8:77694890-77694912 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1043563152 8:81518727-81518749 TTGTATTTGGTGAAAGAAAAGGG + Intergenic
1043768782 8:84170388-84170410 TTGTATATGGTGAAAGTAAAGGG + Intergenic
1043824967 8:84916105-84916127 TCATAAAAGGAAAAGGAAAAAGG + Intronic
1043825036 8:84916961-84916983 TCATAAAAGGAAAAGGAAAAAGG - Intronic
1044283220 8:90380386-90380408 TTGTATAAGGAGTAAGGAAGGGG - Intergenic
1044394483 8:91693981-91694003 TTGTATAAGGTTTAGGAAAGGGG + Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045377597 8:101590674-101590696 AGGTATAAAGAGAAGGAACATGG - Intronic
1045391071 8:101715297-101715319 TTGTATAAGGTGTAAGAAAGGGG - Intronic
1045413852 8:101947078-101947100 TTGTAACAGGAGATGGAACATGG + Intronic
1045895479 8:107210955-107210977 TTGTAACAGGAGATGGAACATGG + Intergenic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1045971936 8:108088551-108088573 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1046236772 8:111434427-111434449 TTGTATATGGTGAAAGGAAAGGG + Intergenic
1046338476 8:112821822-112821844 TTGTATAGGGAGTAAGGAAAGGG + Intronic
1046345978 8:112927733-112927755 TTTTATAAGGTCAAGGAAATAGG - Intronic
1046701720 8:117408153-117408175 ATATATAAGTGGAAGGAAAAAGG + Intergenic
1046972004 8:120233490-120233512 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1047091529 8:121580699-121580721 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1047196141 8:122723013-122723035 TTTTAAAAGGAAGAGGAAAAAGG + Intergenic
1047271048 8:123359097-123359119 TTGTATAATGAAAAGGGAAAAGG + Intronic
1047369109 8:124240740-124240762 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1047417008 8:124672911-124672933 ATATATATGGAGAAAGAAAAAGG + Intronic
1047798671 8:128285620-128285642 AAGAAGAAGGAGAAGGAAAAGGG + Intergenic
1048102491 8:131368936-131368958 TTGAAAATGGAGAATGAAAAAGG - Intergenic
1048703803 8:137126379-137126401 TTGTATAAGGTGCAGGGAAGGGG + Intergenic
1050141134 9:2516851-2516873 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1050683911 9:8145928-8145950 TTCCAGAAGGAGAAGGATAAAGG + Intergenic
1050734419 9:8747274-8747296 TAGAATTAGGAAAAGGAAAAAGG + Intronic
1050803642 9:9646617-9646639 TAGTATAAAGAGGAGGAAGAAGG - Intronic
1051671705 9:19517078-19517100 TTTTAAAAGGTGAATGAAAAGGG - Intronic
1051826442 9:21225830-21225852 TTGTATAAGGTGTAAGGAAAGGG + Intronic
1051926278 9:22330582-22330604 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1052224328 9:26066605-26066627 TTGTATGAGCAGAATGCAAATGG - Intergenic
1052281626 9:26739883-26739905 TTGTATATGGTGAAGGGAAGGGG - Intergenic
1052329868 9:27256527-27256549 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1052379026 9:27750107-27750129 ATGTACCAGGAGAAGGAAACTGG - Intergenic
1052528884 9:29656495-29656517 TACAATTAGGAGAAGGAAAAAGG - Intergenic
1053134529 9:35641973-35641995 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1055127902 9:72740157-72740179 TTGGGAAAGGAAAAGGAAAACGG + Exonic
1055193929 9:73563526-73563548 TTGTATAAGGTGTAAGTAAATGG - Intergenic
1055386384 9:75767119-75767141 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1055541126 9:77306444-77306466 GTGTGTAAAGAGAGGGAAAAGGG + Intronic
1055569188 9:77599360-77599382 TTGAATAGGGGGAAGGAGAATGG + Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055984563 9:82043932-82043954 TTGGAAAAGAAGAAGTAAAACGG - Intergenic
1056704594 9:88941239-88941261 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1056861698 9:90190743-90190765 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1057290731 9:93805449-93805471 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1058140399 9:101351898-101351920 ATGGATAAGGAGAGGGGAAATGG + Intergenic
1058373010 9:104292057-104292079 TTGTATGAGGAGATAGAAATAGG - Intergenic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1058409458 9:104715263-104715285 AAGAAGAAGGAGAAGGAAAAGGG - Intergenic
1058548526 9:106087472-106087494 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1058579698 9:106441481-106441503 TTGTAGATGGGGGAGGAAAAAGG + Intergenic
1058986385 9:110212049-110212071 GTGTAAAAGGTGAAGGAGAAAGG - Intergenic
1059040922 9:110814709-110814731 TTCTTCAACGAGAAGGAAAATGG - Intergenic
1059262264 9:112989295-112989317 TTGTATAAGGTGTAGGGAAGGGG + Intergenic
1059317487 9:113438737-113438759 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1060246781 9:121953139-121953161 TAGTTTAAGGAGGAGGAAAATGG + Intronic
1061854032 9:133431952-133431974 TTTTAAAATCAGAAGGAAAAAGG - Intronic
1062515917 9:136935653-136935675 CTATAAAAAGAGAAGGAAAAAGG - Intronic
1186061631 X:5714459-5714481 TTGTATAAGGAGTAAGGAAGGGG - Intergenic
1186068232 X:5789516-5789538 GTCTAGAGGGAGAAGGAAAAAGG + Intergenic
1186350431 X:8733428-8733450 GTGTATAAGAATAGGGAAAAGGG - Intergenic
1186365045 X:8883451-8883473 TTGTAAATGTAAAAGGAAAATGG - Intergenic
1186568489 X:10689768-10689790 ATGTGTAAGGAGAAGGAAATTGG - Intronic
1186659284 X:11652298-11652320 TTGTATATGGTGAAAGGAAAGGG + Intronic
1186810726 X:13185952-13185974 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1187033894 X:15517428-15517450 TTCTGGAAGGAGCAGGAAAAAGG + Intronic
1187237401 X:17480600-17480622 TTGTATAAGGTGTAAGGAAAGGG - Intronic
1187238464 X:17490297-17490319 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1187259572 X:17672816-17672838 TTCCATAAGGACAAGGACAATGG + Intronic
1187463790 X:19511138-19511160 TTGTATAAGGTGTAAGAAAGGGG - Intronic
1187466709 X:19533895-19533917 TTGTATAAAGTGGAGAAAAATGG + Intergenic
1187746652 X:22416374-22416396 TGGCAGAAGGGGAAGGAAAAAGG - Intergenic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1188155080 X:26731787-26731809 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1188264984 X:28062174-28062196 TTGTATATGGAGAGAGATAAGGG + Intergenic
1188458312 X:30393063-30393085 TCTTAAAATGAGAAGGAAAAAGG + Intergenic
1188628205 X:32314365-32314387 TTGTATAAGGTGTAAGAAAGGGG - Intronic
1188638733 X:32470974-32470996 TTTTATAATAAGTAGGAAAAGGG + Intronic
1188642516 X:32523774-32523796 CTGTATAAGGAGGAAGGAAAGGG + Intronic
1188773463 X:34184223-34184245 TTGATTAAAGAAAAGGAAAATGG - Intergenic
1188892617 X:35629454-35629476 TTGTATAAGGTGAAAGGAAGGGG + Intergenic
1188904380 X:35774532-35774554 TTAGAAAAGGAAAAGGAAAAAGG - Intergenic
1188969304 X:36593767-36593789 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1189190172 X:39094393-39094415 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1191132869 X:57033315-57033337 TTGTATAAGGTGTAAGGAAAAGG + Intergenic
1191160027 X:57319985-57320007 TTGTATAAGGTGTAAGAAAGAGG - Intronic
1191188336 X:57637640-57637662 TTGTATAAGGTGTAAGAAAAGGG - Intergenic
1191595577 X:62940405-62940427 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1191624578 X:63256668-63256690 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1191768439 X:64728456-64728478 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1191780601 X:64860288-64860310 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1191924873 X:66298305-66298327 TAGAATTAGGAGAACGAAAAAGG - Intergenic
1191928196 X:66339050-66339072 TTGTATAAGGTGAAGAAAAGTGG + Intergenic
1192026777 X:67461417-67461439 TTGTATAAGGTGCAAGAAAGGGG - Intergenic
1192680779 X:73251474-73251496 TTTTGGATGGAGAAGGAAAATGG - Intergenic
1192755392 X:74041759-74041781 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1192924580 X:75742030-75742052 GTGTATAAAGAAAGGGAAAAAGG - Intergenic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1193063313 X:77230115-77230137 TTGTATAAGGTGTAAGGAAAAGG - Intergenic
1193081104 X:77406997-77407019 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1193308936 X:79982151-79982173 TTGTATATGGTGAAAGAAAGGGG + Intergenic
1193336969 X:80301516-80301538 TTGTATATGGAAAAAGATAAAGG + Intergenic
1193364716 X:80618344-80618366 TTGTATAAGGTGTAAGGAAATGG + Intergenic
1193385279 X:80863581-80863603 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1193394109 X:80963717-80963739 TTGTATAAGGTGTAAGAAAAGGG + Intergenic
1193438373 X:81508760-81508782 TTGTATAAGGAGTAAGGAAGGGG - Intergenic
1193567146 X:83090803-83090825 TTCTATAAGGAGAAAGAATATGG + Intergenic
1193575979 X:83195706-83195728 TTGTATAAGGTGTAGGGAAGGGG + Intergenic
1193837048 X:86356204-86356226 TTGTATATGGTGAAAGAAAGGGG + Intronic
1193910719 X:87302882-87302904 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1193935657 X:87616920-87616942 TTGCATAACCATAAGGAAAAGGG - Intronic
1194192336 X:90853072-90853094 TTGTATATGGTGAATGAAAGGGG + Intergenic
1194208064 X:91035312-91035334 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1194396391 X:93392510-93392532 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1194523551 X:94947625-94947647 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1194701290 X:97118287-97118309 TAGGGAAAGGAGAAGGAAAATGG - Intronic
1194701924 X:97124928-97124950 TTGTATTAGGGGAAGGACCAAGG + Intronic
1194900972 X:99511180-99511202 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1194989119 X:100526258-100526280 TTGTATAAGGTGAAAGTTAAGGG + Intergenic
1195344445 X:103935514-103935536 TTGTATAAGGTGTAAGGAAAGGG + Intronic
1195502226 X:105614649-105614671 TTGTATAAGGAGAGAGATATGGG - Intronic
1195544023 X:106094957-106094979 TTGTATATGGTGAAAGGAAAGGG + Intergenic
1195548837 X:106143564-106143586 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1195579769 X:106488297-106488319 TTGTATAAGGTGTACGGAAAGGG + Intergenic
1195729771 X:107954768-107954790 TTGTATAAGGTGTATGGAAAGGG + Intergenic
1195837770 X:109138212-109138234 TTATATAAGGTGTAGGAAAGTGG + Intergenic
1196010640 X:110884001-110884023 TTGTATATGGTGAAAGAAAGGGG + Intergenic
1196557639 X:117108368-117108390 TTATACTAGCAGAAGGAAAAGGG - Intergenic
1196676870 X:118429286-118429308 TAATATAAGGATAAGGAAATAGG + Intronic
1197107182 X:122730721-122730743 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1197680319 X:129375846-129375868 TTGTATAAGGTGAAAGGAAGGGG - Intergenic
1197954478 X:131931258-131931280 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1198773225 X:140152638-140152660 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1198981812 X:142406332-142406354 TTGTATAAGGTGCAAGGAAAGGG - Intergenic
1199003888 X:142673370-142673392 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1199007721 X:142721943-142721965 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1199125175 X:144109914-144109936 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1199671522 X:150152080-150152102 TGGTAGGGGGAGAAGGAAAAGGG - Intergenic
1199728485 X:150607554-150607576 ATGTATAGGGAAAAGGATAAAGG - Intronic
1200332503 X:155312337-155312359 TTGTATATGGTGTAGGAAAGGGG + Intronic
1200538971 Y:4435523-4435545 TTGTATATGGTGAATGAAAGGGG + Intergenic
1200739827 Y:6842015-6842037 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1200803762 Y:7411222-7411244 TTGAAAGAGGAGAAGGTAAATGG - Intergenic
1201233911 Y:11892003-11892025 TTTTATGATGGGAAGGAAAAGGG + Intergenic
1201398449 Y:13575601-13575623 TTGTATAAGGTGTAAGGAAAGGG - Intergenic
1201537257 Y:15064268-15064290 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1201563084 Y:15338391-15338413 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1201724004 Y:17134344-17134366 TAGAATTAGGAGAAGGAAAATGG - Intergenic
1201966974 Y:19748704-19748726 TTGTATATGGAGTAATAAAAAGG + Intergenic
1202112617 Y:21439350-21439372 TTGTATAAGGTGTAAGGAAAGGG + Intergenic
1202352870 Y:24012515-24012537 TTATATTATGAGAAGGAAATTGG + Intergenic
1202517909 Y:25657600-25657622 TTATATTATGAGAAGGAAATTGG - Intergenic