ID: 984035744

View in Genome Browser
Species Human (GRCh38)
Location 4:174665281-174665303
Sequence GAACAGTAGTTACCCAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984035744_984035748 15 Left 984035744 4:174665281-174665303 CCTTCTTTGGGTAACTACTGTTC 0: 1
1: 0
2: 2
3: 16
4: 206
Right 984035748 4:174665319-174665341 GCTTGTAAGCTACTTCTTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 129
984035744_984035747 14 Left 984035744 4:174665281-174665303 CCTTCTTTGGGTAACTACTGTTC 0: 1
1: 0
2: 2
3: 16
4: 206
Right 984035747 4:174665318-174665340 AGCTTGTAAGCTACTTCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984035744 Original CRISPR GAACAGTAGTTACCCAAAGA AGG (reversed) Intronic
901614675 1:10529044-10529066 ACAAAGCAGTTACCCAAAGAGGG - Intronic
904399363 1:30245774-30245796 CAGCAGTGGTTACCCATAGAGGG + Intergenic
905936404 1:41827596-41827618 GGGCAGTATTCACCCAAAGATGG - Intronic
906063584 1:42963818-42963840 TAACAGTAGTTACCCTTGGAAGG + Intergenic
906684349 1:47753526-47753548 AACCAGTAGGTAGCCAAAGAGGG + Intergenic
907655931 1:56341954-56341976 GAACAGTAGTTACCAGAGGATGG + Intergenic
911002653 1:93181492-93181514 TTACAGTAGTTACCCAAAAAAGG - Intronic
911063455 1:93767148-93767170 GAACAGTAGTTATCCAGGCAGGG + Intronic
913541783 1:119828058-119828080 GAACAGTAGTTGCCTATGGATGG - Intergenic
916233733 1:162564683-162564705 GAACAGTAGATTCTCAAACAGGG - Intronic
918121511 1:181545168-181545190 GGACAGTAGTTACTCCCAGAAGG + Intronic
918155216 1:181838351-181838373 GAACAGTGGTTACCAGAGGATGG + Intergenic
918294724 1:183145672-183145694 GAAAATAAGTCACCCAAAGAAGG - Intergenic
918475721 1:184922405-184922427 GAACAGTAGTTACCAGAGGCTGG - Intronic
921625477 1:217373768-217373790 GAACCGCAGAAACCCAAAGAGGG - Intergenic
921781523 1:219171069-219171091 GAACTGAAGTTACCAAAAGGAGG + Intergenic
922332573 1:224590342-224590364 GGACAGCAGTTACACAAAAAAGG - Intronic
922547871 1:226472210-226472232 GATCAGTGGTTACCCGAGGATGG + Intergenic
922609690 1:226916427-226916449 TAACAGTAGTTATCTCAAGATGG - Intronic
923704475 1:236332861-236332883 AACCAGTAGTCACTCAAAGAGGG - Intergenic
923758461 1:236816553-236816575 GAAAAGAAGTTACAGAAAGATGG - Intronic
923766844 1:236900445-236900467 GCATAGTAATTACCCACAGAAGG + Exonic
924282869 1:242455815-242455837 CAACAGAAGTGTCCCAAAGATGG + Intronic
1063518347 10:6718602-6718624 AAGCAGTAGTGACTCAAAGAAGG + Intergenic
1063584080 10:7335119-7335141 GAACGGTGGTTGCCCAGAGAAGG + Intronic
1068071239 10:52198923-52198945 GAAAAATGGTTCCCCAAAGATGG - Intronic
1069076147 10:64040527-64040549 GAATAGTGGTTACCAAAGGATGG - Intergenic
1069609052 10:69760147-69760169 AAACAGTAGTTACCCCAGGGAGG - Intergenic
1070168287 10:73913974-73913996 CCACAGTGATTACCCAAAGAAGG + Exonic
1070940842 10:80345598-80345620 GAACAGTGGTTACCAAGAGGTGG - Intronic
1072402998 10:95124744-95124766 GAAGAATAGTGACCCAAGGAAGG + Intergenic
1073851490 10:107624124-107624146 GAATAGTAGTTACCAAAGGCTGG - Intergenic
1078805368 11:14695061-14695083 GAACAGTGGATACCTACAGAAGG - Intronic
1079357417 11:19741434-19741456 GAACAGTTGTTACCTGAAGTGGG - Intronic
1079638993 11:22780614-22780636 AAGCAGTAGTTACTTAAAGAAGG + Intronic
1080289496 11:30654976-30654998 GGAAAGTAGATACCCAAAGATGG + Intergenic
1080648660 11:34205537-34205559 AAACAGTGGTTACCAAAAGTTGG - Intronic
1085109551 11:73875584-73875606 GAACAGAAGTTAGCCAGAGATGG + Intronic
1085165025 11:74391206-74391228 AAAAAGCAGTTACCCAAGGAAGG - Intronic
1086609216 11:88733984-88734006 GAACAGTATTTACCAAAGTATGG + Intronic
1088786992 11:113191076-113191098 GATCAGTAGTAATCCATAGATGG + Intronic
1092271942 12:7030612-7030634 GAACCGTAGAGCCCCAAAGAGGG + Intronic
1092347484 12:7727802-7727824 GAACACAAGATATCCAAAGAAGG - Intergenic
1096796883 12:54083283-54083305 AAAAAGTAGTTACCCAAGTAAGG - Intergenic
1097298884 12:57997446-57997468 GAACTGCAGGTCCCCAAAGAGGG + Intergenic
1097430727 12:59502644-59502666 GAACAGTATTTACACAAATTTGG - Intergenic
1097684320 12:62677445-62677467 GAACTGTAGAGCCCCAAAGAGGG - Intronic
1098008611 12:66025885-66025907 GAACTGTAGAAATCCAAAGAAGG - Intergenic
1098963400 12:76762532-76762554 GAGCAGCAGTTACTCAAAGAGGG - Intergenic
1099993766 12:89754301-89754323 GAATAGTAGTTACCAGAGGATGG + Intergenic
1102835474 12:116054458-116054480 AAATAGTAGGTACTCAAAGAAGG - Intronic
1103337451 12:120200601-120200623 AAACAGTATTTTCCCAAAAATGG + Intronic
1103842316 12:123875182-123875204 GAACAGTAGTATCGCAAAGTAGG - Intronic
1103872865 12:124103260-124103282 GAACAGTAGTTGCCCAAAGGTGG - Intronic
1109333452 13:60960988-60961010 GAACAGTAGTTACCAGAGGCAGG - Intergenic
1109771230 13:66976193-66976215 GAAAAGTAGTTTGCCAATGAGGG - Intronic
1111393064 13:87624744-87624766 GAACGGTAATTCCCAAAAGATGG - Intergenic
1111653658 13:91126064-91126086 GAACAGTAGTTACCAAGGGCTGG - Intergenic
1111698329 13:91653997-91654019 GAACAATGGTTACCTGAAGATGG - Intronic
1113079605 13:106504472-106504494 GACCAGTAGTAACCCCAATAAGG + Intronic
1115033972 14:28834987-28835009 AAACAGTAGCTACTCAATGAAGG - Intergenic
1115050534 14:29055769-29055791 GAACAGTAGTTACCAGATGCTGG - Intergenic
1115570905 14:34665369-34665391 GACCTGTAGTGACCCTAAGAGGG - Intergenic
1117818983 14:59628884-59628906 CAAAAGTAGATATCCAAAGATGG - Intronic
1118106187 14:62662589-62662611 GAACAGTGGTTACCCGAGGCTGG + Intergenic
1118608846 14:67523932-67523954 GAAGAATAGTGACACAAAGAGGG + Intronic
1119015971 14:71055086-71055108 GAACAGTAGTTCCCAAAATGTGG - Intronic
1119937659 14:78607521-78607543 TAATAGTATTGACCCAAAGAAGG - Intronic
1120944435 14:89980813-89980835 TAACACTGGTTACCCCAAGAAGG - Intronic
1121510915 14:94512760-94512782 AGTCAGTAGTTACCCAAATAGGG + Intronic
1122026056 14:98877811-98877833 GAACAGTAGTTCCCTACAGTGGG + Intergenic
1124824063 15:33075770-33075792 GAAGAGTCCTTCCCCAAAGAAGG - Intronic
1127163424 15:56216624-56216646 GAACAGAACTAACCTAAAGAAGG - Intronic
1127271365 15:57404765-57404787 GAACAGTCATTAGCCAAACATGG + Intronic
1128025931 15:64436668-64436690 ACACAGTAGGAACCCAAAGAAGG - Intronic
1128965391 15:72052617-72052639 GAACCGTAGAGCCCCAAAGAGGG - Intronic
1131296256 15:91151911-91151933 AAACAGTAGTTACTCAAAGAAGG + Intronic
1132232799 15:100196893-100196915 AACCTGTAATTACCCAAAGAGGG + Intronic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1134759878 16:16704766-16704788 GAACAGTGGTTGCCCAGGGATGG - Intergenic
1134769865 16:16798844-16798866 GAACAGTAGTTCTCCAAGCATGG - Intergenic
1134986194 16:18654439-18654461 GAACAGTGGTTGCCCAGGGATGG + Intergenic
1137441506 16:48502273-48502295 GGATTGTAGTTACCAAAAGAAGG + Intergenic
1139522048 16:67489014-67489036 TAACAGTAGTTACACAGATAGGG - Intergenic
1139823719 16:69740672-69740694 GAGCAGGAGTTTCACAAAGATGG + Intergenic
1140016265 16:71189217-71189239 TAACAGTGGTTACCTACAGAAGG + Intronic
1140922377 16:79551107-79551129 GTACAGTAGTTCCTCAAGGAAGG - Intergenic
1142914787 17:3127453-3127475 GAACAGGAAGGACCCAAAGAGGG + Exonic
1144000233 17:11047356-11047378 GAACGTTACTTACCCAAAAAAGG + Intergenic
1147811888 17:43176892-43176914 TAACATTGGTTACCCAAAGAAGG - Intronic
1152941353 17:83174328-83174350 GTACAGTATTTACCCAATGCCGG + Intergenic
1156343328 18:36232659-36232681 GAATAGTAGTTACCAAAAGCAGG - Intronic
1156681691 18:39597354-39597376 GACCAGTAGTTAGCAAAAAAAGG + Intergenic
1156793013 18:41001375-41001397 GAAGGGTGGTTACCAAAAGATGG + Intergenic
1158023299 18:52869004-52869026 GAACTGCAGTGCCCCAAAGAGGG + Intronic
1161878581 19:6931095-6931117 GAACAGCAGTTACCAGAAGCTGG - Intronic
1164050779 19:21584666-21584688 GAAGAGAAGTCACCCACAGAAGG + Intergenic
1164708644 19:30339114-30339136 GAACAGCTGTCACCCAAAGGAGG - Intronic
1165298476 19:34948822-34948844 GATCAGTGGTTTCCTAAAGACGG + Intergenic
1165550071 19:36576394-36576416 GAACAGTAGTTACAATTAGAAGG - Intronic
1166651821 19:44580743-44580765 GAACAGTTGTAAACCGAAGAGGG - Intergenic
1168630074 19:57949665-57949687 GAACAGCAGAACCCCAAAGAGGG + Intergenic
927310205 2:21622033-21622055 AAACAGTGGTTACCAAAATAAGG - Intergenic
929422586 2:41808660-41808682 AAACAGTAGTTGCTTAAAGACGG + Intergenic
929451808 2:42042909-42042931 GAAAAGTAGTCAAACAAAGACGG - Intergenic
929492551 2:42408891-42408913 GAACAGCAGGGCCCCAAAGAGGG - Intronic
929685749 2:44032735-44032757 GATCAGTATTTACAGAAAGAAGG + Intergenic
930930168 2:56873177-56873199 AAACAGGAATTATCCAAAGACGG + Intergenic
931192276 2:60015558-60015580 GAACAGTTGTTACCAGAAGCTGG + Intergenic
931733738 2:65176234-65176256 GAACCGTAGAACCCCAAAGAGGG + Intergenic
936512601 2:113160318-113160340 GCACACAAGTTACCCAAAGTAGG - Intronic
938150193 2:128875741-128875763 GAAGAGTAGTTTCCAAGAGAAGG - Intergenic
941294027 2:163713827-163713849 GCACAGTATTAACACAAAGAGGG + Intronic
942126607 2:172832064-172832086 GGACAGTGTTTACCCACAGAAGG + Intronic
943550209 2:189329306-189329328 AAACAGTAGTTACCAAGAGGTGG + Intergenic
944022601 2:195125072-195125094 GAACTGCAGAGACCCAAAGAGGG + Intergenic
944159898 2:196647926-196647948 GAACAGTAGTTAACAAAGGCTGG - Intronic
945221622 2:207489773-207489795 GAACAGTATAGACCCAGAGAGGG + Intergenic
946136046 2:217647999-217648021 GAACAATAGCTTCCCAAAGATGG + Intronic
947352320 2:229258950-229258972 GATCAGTAGTTACCTGAGGATGG - Intronic
1169774225 20:9234837-9234859 GAAATGTAAATACCCAAAGAAGG + Intronic
1174709492 20:52689966-52689988 GAAAAACAGTTACCCAAAAAGGG - Intergenic
1175759650 20:61553054-61553076 GAAAAGTAGATAACCAAAGGTGG + Intronic
1177521505 21:22233800-22233822 GAACAGAATTTACACAAAGATGG - Intergenic
1178571904 21:33746039-33746061 GCACAGTAGTCAGCCAATGATGG - Intronic
1179407446 21:41137343-41137365 GAACTGCAGATCCCCAAAGAGGG - Intergenic
949102047 3:157346-157368 GAGCTGTAGCTACACAAAGATGG + Intergenic
950060363 3:10066232-10066254 GAACAGTAGTTCCACAGTGAAGG - Intronic
953164380 3:40451934-40451956 AAGCAGTAGTCACTCAAAGAGGG - Intergenic
953627929 3:44586014-44586036 GAAGGGAAGTTACCCAAAGATGG + Intronic
953951040 3:47190427-47190449 GAACAGCAGTTAACCAAAGCAGG + Intergenic
957375797 3:79355579-79355601 GAACAGTGGTTACCAGAGGACGG - Intronic
958149797 3:89675960-89675982 GAACAGTAATTTCTGAAAGAGGG - Intergenic
958161131 3:89818127-89818149 GAACAATAGAGCCCCAAAGATGG + Intergenic
959826381 3:110801950-110801972 AAACAGTAGTTACCAAAGGTAGG + Intergenic
961953708 3:130777802-130777824 AAACAGTGGTTTACCAAAGATGG + Intergenic
962514950 3:136141646-136141668 GAACACAAGCTAGCCAAAGAGGG + Intronic
963949153 3:151179556-151179578 GTACTGTAATTACCCCAAGAAGG + Intronic
964876678 3:161375348-161375370 GAAGAGAAGTTACTAAAAGATGG - Intergenic
966805112 3:183801106-183801128 GAACTGTAATAACCCTAAGATGG + Intronic
966909481 3:184551047-184551069 GTACAGCAGTTCCCCAAAGTGGG + Intronic
967006110 3:185384112-185384134 GAACAATAGTTACCAGAAGCTGG - Intronic
967417929 3:189239610-189239632 GGGCAGGAGTTAGCCAAAGAAGG + Intronic
967676317 3:192302809-192302831 GAACAGGAGTTAGCTAAACAAGG + Intronic
969315039 4:6376943-6376965 GAACAGCAGGTGCCCAGAGAGGG + Intronic
970178577 4:13363937-13363959 AAACAGTTGCTTCCCAAAGATGG - Intronic
970895497 4:21098607-21098629 GAACAGTAGTTCCCAACAGCAGG - Intronic
973159477 4:46997512-46997534 GAATGGTAGTTACCAAAGGAGGG - Intronic
974107031 4:57481353-57481375 GAACAGCAGTTACCAGAAGATGG + Intergenic
974848344 4:67378706-67378728 GATCAGGTGTTGCCCAAAGAGGG - Intergenic
976985252 4:91287372-91287394 GAACAGTAGATACAGAAAAAAGG - Intronic
977490075 4:97700094-97700116 GGAGAGTAGTTATCCACAGATGG + Intronic
977727666 4:100315994-100316016 GAATAGTGGTTACCTGAAGATGG - Intergenic
978061603 4:104345803-104345825 GAACTGCAGATGCCCAAAGAGGG - Intergenic
980644897 4:135631171-135631193 CAACAGCAGTTACCAAAAAAGGG - Intergenic
980882844 4:138731019-138731041 GAATACTATTTACCCAAACAAGG + Intergenic
981973445 4:150693671-150693693 GAACAGTGGTTACCTTAACAGGG + Intronic
982157947 4:152539911-152539933 GAACTGCAGGGACCCAAAGAGGG + Intergenic
982893213 4:160882476-160882498 GAATAGTGGTTACCCGAAGCAGG + Intergenic
983007791 4:162506864-162506886 GAACAGTAATTTTTCAAAGAAGG - Intergenic
983214955 4:164993956-164993978 CAACATTAGTCACCCAAAAAAGG - Intergenic
983394495 4:167176303-167176325 GAAAAATGGTTCCCCAAAGATGG - Intronic
983806248 4:171996983-171997005 GAACTGTAGTTACTTACAGATGG - Intronic
984035744 4:174665281-174665303 GAACAGTAGTTACCCAAAGAAGG - Intronic
984291513 4:177801005-177801027 GAGCAGTAGTTACCAGAGGATGG - Intronic
986635304 5:9815897-9815919 GAACATTAATGACCCTAAGAGGG - Intergenic
990676313 5:58190028-58190050 GAAATGTAGTTACCCAAATTAGG - Intergenic
991071197 5:62482609-62482631 GATCAGGAGTTACACAATGATGG + Intronic
991417970 5:66411120-66411142 GAATAATGGTTGCCCAAAGATGG + Intergenic
992676447 5:79111037-79111059 TAACAGTAGTTACCTATTGATGG - Intronic
993298398 5:86174280-86174302 TAACAGTAGTTACCCAACTTAGG + Intergenic
993829741 5:92740054-92740076 ATACAGAAGTTACCTAAAGAAGG - Intergenic
994104763 5:95935092-95935114 GAACAGTGGTTACCCATGAAGGG - Intronic
994200116 5:96964059-96964081 GAACAGTAGTTACCAAAGACTGG - Intronic
994412825 5:99431063-99431085 GAATAGTGGTTACCAAAAGCTGG - Intergenic
994481016 5:100334657-100334679 GAATAGTGGTTACCAAAAGCTGG + Intergenic
997270459 5:132532348-132532370 TAACAGTAGTTCCCAACAGAGGG - Intergenic
999842641 5:155445714-155445736 GATCAGTAATTGCCCAATGATGG - Intergenic
1003047584 6:2748108-2748130 GAACAGTAGCTGGGCAAAGAAGG + Intronic
1004102157 6:12624671-12624693 GAACAGTGGTTACCAAAGGCTGG + Intergenic
1004905117 6:20230187-20230209 GAAGGGTAGTTTCCTAAAGAAGG + Intergenic
1006191910 6:32214598-32214620 GAACAGTAGCCACACAAAGTAGG + Intronic
1009346976 6:62625269-62625291 AAACAACAGTTACCCACAGAAGG - Intergenic
1010573646 6:77507449-77507471 GAAGAAAAGTTACCCAAGGAGGG + Intergenic
1010766495 6:79781676-79781698 GAACAGATGTTACCCATGGAAGG + Intergenic
1013702838 6:112794963-112794985 GGTCAGTAATTACCCACAGAGGG - Intergenic
1017612177 6:156199475-156199497 AAAGAGAAGTTAACCAAAGAAGG + Intergenic
1024220095 7:47280543-47280565 GAACAGTTGTTACCAGTAGACGG + Intronic
1027860577 7:83573700-83573722 GATTAGTAGTTACCCTAAAAAGG - Intronic
1029818921 7:103126501-103126523 GAACAGTTGTGTCCCAAAGGAGG - Intronic
1031550024 7:123098600-123098622 GAACAGTGGTTACCAGAAGCTGG + Intergenic
1031780962 7:125963699-125963721 GAACAGTGGTTACCAAGAGCAGG + Intergenic
1032519285 7:132531046-132531068 GAACAGCGGTTACCCAGAGCTGG + Intronic
1034486285 7:151365840-151365862 AAACAGTAGTCTCCTAAAGAGGG - Intronic
1035393831 7:158522956-158522978 GAACAAAAGTTACCCAAAAATGG + Intronic
1035645651 8:1216802-1216824 GAACAGTAGTAACCTAATCAGGG + Intergenic
1039662096 8:39478778-39478800 GCACAGTACTCACCTAAAGAAGG - Intergenic
1040654354 8:49488377-49488399 GAAAAGTAGTTACAAAAGGAAGG + Intergenic
1041604450 8:59763178-59763200 AAACAATAGTAATCCAAAGAAGG + Intergenic
1041976852 8:63809275-63809297 GACCAGTGGTTACCTGAAGAGGG + Intergenic
1043736853 8:83758942-83758964 GAACAGTGGTTACCCGAAACTGG + Intergenic
1043848637 8:85190370-85190392 GAACAGTGGTCCCTCAAAGATGG + Intronic
1044047141 8:87450284-87450306 GAATAGTGGTTACCAAAAGCTGG + Intronic
1045116552 8:98989240-98989262 GAACAGTAGTTAGCCAGGTAAGG - Intergenic
1046052518 8:109040491-109040513 GAACAGTTGTTTCCCTTAGATGG + Intergenic
1046574986 8:116016848-116016870 GAACAAGAGTTACACAAGGAAGG - Intergenic
1049305952 8:141904194-141904216 CAACAGGAGTTAGCCATAGAAGG + Intergenic
1052186256 9:25599322-25599344 TATCAGTAGCTACGCAAAGAAGG + Intergenic
1057111572 9:92477123-92477145 GAACAGTAGTCAGCCACAGTTGG - Intronic
1058603909 9:106700541-106700563 GTACAGGAGCTACCCAAAGCAGG - Intergenic
1059502579 9:114767590-114767612 GAATAGGAGTTAACCAGAGAAGG + Intergenic
1062001549 9:134218431-134218453 GATCAGTAGCTCCCCACAGATGG + Intergenic
1186358405 X:8811768-8811790 GAACAGCAGATACCCATGGAAGG - Intergenic
1186900978 X:14055672-14055694 GAACAGTGGTTACCAGAAGCTGG - Intergenic
1187209731 X:17217570-17217592 CAGCAGTAGCCACCCAAAGATGG + Intergenic
1188221893 X:27550698-27550720 GAATAGTAGTTACCAGAGGATGG - Intergenic
1188583577 X:31745340-31745362 GAACACTAGATGCCCAAATAAGG + Intronic
1189741011 X:44117173-44117195 GAACAGTAGTTTCCCAAGTGTGG - Intergenic
1192384391 X:70651243-70651265 GAACAGTGGTTACCTATTGAGGG - Intronic
1192574410 X:72231380-72231402 GAACAGTAGTTACCAGAGGCTGG + Intronic
1193124139 X:77853260-77853282 AAACAGTAATTACTCAAAGATGG - Intronic
1199583569 X:149386715-149386737 GAACAGTAGTTCCCAAAGGAAGG + Intergenic
1199673765 X:150167259-150167281 GAACAGTGGCAGCCCAAAGATGG + Intergenic
1200390323 X:155938591-155938613 GAAGAGTAGTGACTAAAAGAAGG - Intronic
1201986125 Y:19968829-19968851 GAATAGTGGTTGCCCAAAGAAGG + Intergenic