ID: 984041183

View in Genome Browser
Species Human (GRCh38)
Location 4:174735757-174735779
Sequence GACCAGCCTGGCGAACATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5378
Summary {0: 1, 1: 65, 2: 1013, 3: 1918, 4: 2381}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984041183_984041186 -4 Left 984041183 4:174735757-174735779 CCGTCATGTTCGCCAGGCTGGTC 0: 1
1: 65
2: 1013
3: 1918
4: 2381
Right 984041186 4:174735776-174735798 GGTCTGGAACTCCTGACCTCAGG 0: 2171
1: 61688
2: 87472
3: 60572
4: 28921
984041183_984041191 29 Left 984041183 4:174735757-174735779 CCGTCATGTTCGCCAGGCTGGTC 0: 1
1: 65
2: 1013
3: 1918
4: 2381
Right 984041191 4:174735809-174735831 ACGTCAGCCTCCCAAAGTGTTGG 0: 14
1: 3077
2: 43674
3: 149305
4: 237968
984041183_984041192 30 Left 984041183 4:174735757-174735779 CCGTCATGTTCGCCAGGCTGGTC 0: 1
1: 65
2: 1013
3: 1918
4: 2381
Right 984041192 4:174735810-174735832 CGTCAGCCTCCCAAAGTGTTGGG 0: 40
1: 8391
2: 114523
3: 233321
4: 244023

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984041183 Original CRISPR GACCAGCCTGGCGAACATGA CGG (reversed) Intronic