ID: 984041186

View in Genome Browser
Species Human (GRCh38)
Location 4:174735776-174735798
Sequence GGTCTGGAACTCCTGACCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240824
Summary {0: 2171, 1: 61688, 2: 87472, 3: 60572, 4: 28921}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984041183_984041186 -4 Left 984041183 4:174735757-174735779 CCGTCATGTTCGCCAGGCTGGTC 0: 1
1: 65
2: 1013
3: 1918
4: 2381
Right 984041186 4:174735776-174735798 GGTCTGGAACTCCTGACCTCAGG 0: 2171
1: 61688
2: 87472
3: 60572
4: 28921

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984041186 Original CRISPR GGTCTGGAACTCCTGACCTC AGG Intronic