ID: 984041191

View in Genome Browser
Species Human (GRCh38)
Location 4:174735809-174735831
Sequence ACGTCAGCCTCCCAAAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434038
Summary {0: 14, 1: 3077, 2: 43674, 3: 149305, 4: 237968}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984041188_984041191 -6 Left 984041188 4:174735792-174735814 CCTCAGGTGATATGCCCACGTCA 0: 1
1: 40
2: 3152
3: 14186
4: 37486
Right 984041191 4:174735809-174735831 ACGTCAGCCTCCCAAAGTGTTGG 0: 14
1: 3077
2: 43674
3: 149305
4: 237968
984041185_984041191 17 Left 984041185 4:174735769-174735791 CCAGGCTGGTCTGGAACTCCTGA 0: 3961
1: 108540
2: 173561
3: 217028
4: 147244
Right 984041191 4:174735809-174735831 ACGTCAGCCTCCCAAAGTGTTGG 0: 14
1: 3077
2: 43674
3: 149305
4: 237968
984041183_984041191 29 Left 984041183 4:174735757-174735779 CCGTCATGTTCGCCAGGCTGGTC 0: 1
1: 65
2: 1013
3: 1918
4: 2381
Right 984041191 4:174735809-174735831 ACGTCAGCCTCCCAAAGTGTTGG 0: 14
1: 3077
2: 43674
3: 149305
4: 237968
984041187_984041191 -1 Left 984041187 4:174735787-174735809 CCTGACCTCAGGTGATATGCCCA No data
Right 984041191 4:174735809-174735831 ACGTCAGCCTCCCAAAGTGTTGG 0: 14
1: 3077
2: 43674
3: 149305
4: 237968

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984041191 Original CRISPR ACGTCAGCCTCCCAAAGTGT TGG Intronic