ID: 984041192

View in Genome Browser
Species Human (GRCh38)
Location 4:174735810-174735832
Sequence CGTCAGCCTCCCAAAGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600298
Summary {0: 40, 1: 8391, 2: 114523, 3: 233321, 4: 244023}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984041185_984041192 18 Left 984041185 4:174735769-174735791 CCAGGCTGGTCTGGAACTCCTGA 0: 3961
1: 108540
2: 173561
3: 217028
4: 147244
Right 984041192 4:174735810-174735832 CGTCAGCCTCCCAAAGTGTTGGG 0: 40
1: 8391
2: 114523
3: 233321
4: 244023
984041183_984041192 30 Left 984041183 4:174735757-174735779 CCGTCATGTTCGCCAGGCTGGTC 0: 1
1: 65
2: 1013
3: 1918
4: 2381
Right 984041192 4:174735810-174735832 CGTCAGCCTCCCAAAGTGTTGGG 0: 40
1: 8391
2: 114523
3: 233321
4: 244023
984041188_984041192 -5 Left 984041188 4:174735792-174735814 CCTCAGGTGATATGCCCACGTCA 0: 1
1: 40
2: 3152
3: 14186
4: 37486
Right 984041192 4:174735810-174735832 CGTCAGCCTCCCAAAGTGTTGGG 0: 40
1: 8391
2: 114523
3: 233321
4: 244023
984041187_984041192 0 Left 984041187 4:174735787-174735809 CCTGACCTCAGGTGATATGCCCA No data
Right 984041192 4:174735810-174735832 CGTCAGCCTCCCAAAGTGTTGGG 0: 40
1: 8391
2: 114523
3: 233321
4: 244023

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984041192 Original CRISPR CGTCAGCCTCCCAAAGTGTT GGG Intronic