ID: 984041782

View in Genome Browser
Species Human (GRCh38)
Location 4:174744155-174744177
Sequence CAACCCAGCATTGCAGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984041779_984041782 9 Left 984041779 4:174744123-174744145 CCTGAGAGCTATGTGTCTGGGGC 0: 1
1: 0
2: 3
3: 32
4: 196
Right 984041782 4:174744155-174744177 CAACCCAGCATTGCAGCCACTGG 0: 1
1: 0
2: 3
3: 19
4: 193
984041775_984041782 27 Left 984041775 4:174744105-174744127 CCATCAAAAGTAGTTAGGCCTGA 0: 1
1: 0
2: 1
3: 4
4: 91
Right 984041782 4:174744155-174744177 CAACCCAGCATTGCAGCCACTGG 0: 1
1: 0
2: 3
3: 19
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984041782 Original CRISPR CAACCCAGCATTGCAGCCAC TGG Intronic
901195684 1:7438626-7438648 CACAGCTGCATTGCAGCCACAGG - Intronic
901600763 1:10421801-10421823 GCACCCAGCCTTGCTGCCACTGG - Intergenic
901930031 1:12591289-12591311 CAGCCCAGCAGTGCAGGAACAGG - Intronic
901939570 1:12651749-12651771 CATCCCAGCCTCCCAGCCACGGG + Intronic
902229080 1:15015942-15015964 CAACCCAGCAGAGCAGGGACGGG - Intronic
903159240 1:21473197-21473219 CAACAGAGCATGGCAGCCATGGG - Intronic
904499550 1:30906327-30906349 CCACCCACCATTTCAGCCTCTGG + Intronic
906561144 1:46757867-46757889 CAACCAAGAATTGCTGGCACAGG - Intronic
911793934 1:102053586-102053608 GAGCCCAGCTTTGCAGCCAATGG + Intergenic
912192048 1:107352089-107352111 CAACCCATGAAAGCAGCCACAGG - Intronic
915216151 1:154342018-154342040 CATCCCAGCAGCACAGCCACGGG - Intronic
916465753 1:165073189-165073211 CATACCAGCATTGCTGCCCCAGG - Intergenic
916530692 1:165653634-165653656 CACCCCAGCATGACAGCCAAAGG + Intronic
921536113 1:216350771-216350793 GAACCCAGAATGGTAGCCACTGG - Intronic
921650727 1:217674756-217674778 CAAACCAGCCCTGGAGCCACAGG - Intronic
922240580 1:223753038-223753060 CACCCCAGCCTAGCAGCCCCAGG + Intronic
923046513 1:230360022-230360044 CAGCACAGCCTTGCAGCCTCCGG + Intronic
923426925 1:233879823-233879845 CAACCCAGCAATCCCACCACTGG - Intergenic
923883942 1:238134574-238134596 AAACCCATAATTGCAGCCATGGG - Intergenic
1063454361 10:6172886-6172908 CGCCCCAGCACTGCAGTCACAGG - Intronic
1064389867 10:14932729-14932751 CAACTTAGGATTGCAGCCTCAGG + Intronic
1064394883 10:14973876-14973898 CAACTTAGGATTGCAGCCTCAGG + Intronic
1065190683 10:23204962-23204984 CAACAAAGCATTGCAGCCTGCGG + Intronic
1065994810 10:31048297-31048319 CAATTCAGCAATGCAGCCATTGG + Intergenic
1066052464 10:31648264-31648286 CAACCAGGCATTGGAGCCCCTGG + Intergenic
1067801787 10:49364004-49364026 CCACCCAGCCCTGCAGCCTCAGG + Intergenic
1068946711 10:62736634-62736656 AAGCCCAGCAATGCAGCCAGTGG + Intergenic
1069677749 10:70260558-70260580 CAACCCAGCATTAGAGGCAGTGG + Intronic
1070872614 10:79770209-79770231 CAACCCAGAATTCCAGACAGGGG + Intergenic
1071639536 10:87292358-87292380 CAACCCAGAATTCCAGACAGGGG + Intergenic
1071655699 10:87445594-87445616 CAACCCAGAATTCCAGACAGGGG - Intergenic
1075559744 10:123460025-123460047 CAGCCCAGCACTGCACCTACAGG - Intergenic
1075676151 10:124296958-124296980 CCTCCCAGCATGGCAGCCTCAGG + Intergenic
1076266340 10:129112365-129112387 CAACCCAGCATCTCAGCCCCTGG - Intergenic
1076567376 10:131407997-131408019 CAAGCCAGCATTTCAGCCACAGG + Intergenic
1076647082 10:131961061-131961083 CAAGCCAGGAATCCAGCCACAGG + Intergenic
1080086421 11:28288290-28288312 CAACCCAGCAATGCCACCACTGG + Intronic
1081679553 11:44992147-44992169 CAAGCCACCATGGGAGCCACTGG + Intergenic
1082218030 11:49598381-49598403 CAACCCAGCAATCCTGTCACTGG - Intergenic
1084731368 11:71075725-71075747 CAGCCCTGCACTGCATCCACAGG + Intronic
1085156754 11:74302614-74302636 CAACCCAGCATTCAAGAAACAGG + Intronic
1088283125 11:108157018-108157040 CAACCCTGAAATGCAGTCACTGG + Intergenic
1090766293 11:129879139-129879161 CTGCCCAGCATAGAAGCCACAGG + Intronic
1090947353 11:131442995-131443017 CAACCCAGCATTCCCACTACTGG - Intronic
1091841318 12:3623411-3623433 CATCCCAGGACTGCAGACACTGG + Intronic
1092202104 12:6591908-6591930 CTACATACCATTGCAGCCACAGG + Exonic
1093413294 12:18892541-18892563 CAACCCAGCCTTGCATCCCCAGG + Intergenic
1093916239 12:24805358-24805380 AAACCCAACATTGCATCTACTGG - Intergenic
1098167745 12:67715460-67715482 CATCCCAGGATTGCAGCCACTGG - Intergenic
1100588447 12:96001011-96001033 CCCACCAGCATTGCAGTCACGGG + Exonic
1101047201 12:100820754-100820776 CAACCCAGCATTGCAAACCCAGG - Intronic
1103874033 12:124113608-124113630 CACCCCAGCATGGCAGGCACAGG - Intronic
1104174650 12:126318270-126318292 CAACCCCGCATGGCAGCAGCTGG - Intergenic
1104589502 12:130073064-130073086 AAACCCAGATTTGCAACCACTGG + Intergenic
1105422991 13:20269641-20269663 CCGCCCAGCATGGCAGCCACTGG - Intergenic
1106130615 13:26936371-26936393 CAACCCATGAAAGCAGCCACAGG + Intergenic
1108076291 13:46682791-46682813 CAGCCCTGCTTTGCAGCCATGGG + Intronic
1108826287 13:54416247-54416269 CAAGCCAGCCCTGGAGCCACAGG - Intergenic
1111217451 13:85163072-85163094 CAACCCATGACAGCAGCCACGGG - Intergenic
1111908528 13:94283880-94283902 CAGCCCAGGATGGCAGCCTCTGG + Intronic
1113469639 13:110535262-110535284 CCATCCAGCATGGTAGCCACTGG - Intronic
1114692757 14:24600581-24600603 CAACCCACCACTGCCACCACTGG - Intergenic
1115918743 14:38347368-38347390 GAACTCAGCAGTGAAGCCACTGG - Intergenic
1116523841 14:45880699-45880721 CAACCCATCAATGCTGCCACAGG + Intergenic
1117198728 14:53366336-53366358 CTGTGCAGCATTGCAGCCACTGG - Intergenic
1117690141 14:58298183-58298205 GAACCCAGAATTGCAGCCAGGGG - Intergenic
1119757771 14:77130902-77130924 CAACCCAGCACTGAAGCCTCTGG + Intronic
1121445302 14:93974968-93974990 CAAACCAGCATGGCACCCAGCGG + Intronic
1122068395 14:99189574-99189596 CACCCCAGCATGGCGGCTACTGG + Intronic
1122266753 14:100550245-100550267 CAGCCCAGCATCCCAGCCAAGGG - Intronic
1122521240 14:102345346-102345368 CCAACCAGGGTTGCAGCCACAGG - Intronic
1124234157 15:27972363-27972385 CAATCCAGCAATCCAGTCACTGG - Intronic
1124637501 15:31374363-31374385 CAACACAGCATGGCAGCCAGAGG - Exonic
1125806545 15:42498069-42498091 CAGCCCAGCAGAGCAGCCTCTGG - Intronic
1127300782 15:57651499-57651521 CAGGCCAGCTTTGCAGCCATAGG + Intronic
1129137265 15:73565670-73565692 CACCTCAGTATTACAGCCACTGG + Intronic
1131530031 15:93183039-93183061 CAACGCAGCACTGCAGCCTGGGG - Intergenic
1135140992 16:19921817-19921839 ACAGCCAGCATTGAAGCCACTGG - Intergenic
1135790892 16:25394472-25394494 TAATCCAGCATTGCAGCCACTGG - Intergenic
1138498227 16:57421803-57421825 AAAGCCAGCATGGCAACCACGGG + Intergenic
1139391779 16:66610022-66610044 CACCCCAGCAGTGCTGCAACAGG + Intronic
1142177545 16:88651935-88651957 TAAACCAGCATTGCTGCCTCCGG - Exonic
1144944856 17:18964661-18964683 AATGCCAGCCTTGCAGCCACAGG + Intronic
1147185026 17:38708554-38708576 CTACCCAGCATAGTAGCCATCGG + Intronic
1150317985 17:64186009-64186031 CAGCCCAGCATTGCTGTCAGGGG - Intronic
1152326917 17:79646973-79646995 CAGCCCAGCAGTGGAGCCAGGGG + Intergenic
1153513152 18:5877496-5877518 TAGCCCAGAATTGCAGCTACGGG - Intergenic
1155154105 18:23143975-23143997 CAACACAGTATGGCAGCAACAGG - Intronic
1155680149 18:28477641-28477663 CTACCCAGCAATGGAGACACTGG - Intergenic
1157520075 18:48339350-48339372 ACACCCAGCATTGCAGACAAGGG + Intronic
1157829001 18:50839654-50839676 CAAGCCAGCAGGGCTGCCACTGG + Intergenic
1159047479 18:63383053-63383075 CCACACAGCATGGCTGCCACGGG - Intergenic
1162394508 19:10409067-10409089 CAGCCCAGCCTGGGAGCCACTGG - Intronic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1163419400 19:17205766-17205788 AAGGCCAGCATGGCAGCCACTGG - Intronic
1164506849 19:28867978-28868000 CGACCCAGCAATCCCGCCACTGG + Intergenic
1165139207 19:33688977-33688999 AAAGCTAGCATTCCAGCCACAGG + Intronic
1165759519 19:38312613-38312635 CCACCCACTATTGCAGGCACAGG + Intronic
1167817434 19:51896091-51896113 CAACACAGCATTTATGCCACTGG - Intronic
925014031 2:508312-508334 CACCCCAGCATTACAGACAGTGG + Intergenic
927678478 2:25124144-25124166 CAGCCCAGCACAGCTGCCACCGG - Intronic
927854279 2:26518088-26518110 GAAGCCAGGACTGCAGCCACAGG - Intronic
929765347 2:44839469-44839491 CAACCAAACATTGCAATCACAGG - Intergenic
933112026 2:78414546-78414568 CAACCCAGCAATACTGCTACTGG + Intergenic
934574996 2:95394472-95394494 CGACCCATCGCTGCAGCCACTGG - Intergenic
937223636 2:120356161-120356183 CAACCCAGTTTTGAGGCCACTGG + Intergenic
941736824 2:168986750-168986772 CAACACAGCGTCTCAGCCACAGG - Intronic
942155417 2:173122514-173122536 TAACCCTGCAGTGCTGCCACAGG - Intronic
943103835 2:183518706-183518728 AAACCCAGCAGAGCAGCCAGAGG + Intergenic
944198164 2:197077020-197077042 CAACCCAGCAATCCCACCACTGG - Intronic
946515045 2:220402642-220402664 CAACCCATGAAAGCAGCCACAGG + Intergenic
947545636 2:231008448-231008470 GGACCCAGCAGGGCAGCCACTGG + Intronic
948505455 2:238424628-238424650 CAGCCCAGCACAGCAGCAACAGG - Intergenic
1169040546 20:2491161-2491183 CTATCCAGTATAGCAGCCACTGG + Intronic
1169081210 20:2798683-2798705 CAGCCCAGACTTGCAGCCCCTGG - Intronic
1169161292 20:3380873-3380895 AAATCCAGCATTGTAGTCACAGG + Intronic
1170122070 20:12922669-12922691 CAACCCATGAGAGCAGCCACAGG + Intergenic
1174311869 20:49662425-49662447 CAACACACCATTCTAGCCACTGG - Intronic
1175921490 20:62452453-62452475 CACCCCAGCATGGCAGGCCCAGG + Intergenic
1179319951 21:40281031-40281053 CTTCCCAACATTGCAGCCAAGGG - Intronic
1179429863 21:41313871-41313893 CAACCCAACATTCCATCTACAGG - Intronic
1179678506 21:43001281-43001303 CAACACGGCATGGGAGCCACTGG - Intronic
1181040032 22:20187771-20187793 CCACCCAGCCATGCAGCCTCAGG - Intergenic
1183275899 22:36897587-36897609 CAACCCAAGAGAGCAGCCACAGG + Intergenic
1185033955 22:48461059-48461081 CAACTCCCCATTGCAGCCCCGGG + Intergenic
1185347436 22:50316787-50316809 CAACCCAGCCTGGAAGCCATAGG - Intronic
949642415 3:6052757-6052779 CGACCAACCACTGCAGCCACTGG - Intergenic
951740052 3:25911667-25911689 CAACCCAACAAAGCAACCACAGG - Intergenic
953389103 3:42524286-42524308 CTTCCCATCATTGCAGCCAGAGG - Intronic
959572423 3:107899229-107899251 CTAGCCAGCATTGCAGCCGCTGG - Intergenic
960640516 3:119818186-119818208 ATACCCAGCATTCCAGCCCCAGG - Exonic
962162438 3:133013403-133013425 CAACCCATGAGAGCAGCCACAGG + Intergenic
963579023 3:147100692-147100714 CATCCCAGCATTGTAGCCAAGGG + Intergenic
963777270 3:149452004-149452026 CAACCCATGAAAGCAGCCACAGG - Intergenic
965266379 3:166549063-166549085 CAACCCAGCATTCCTACTACTGG + Intergenic
965697938 3:171428697-171428719 CAGCACAGAATTGCAGCTACTGG - Intronic
967883609 3:194318414-194318436 CAACCCATGAGAGCAGCCACAGG - Intergenic
969695661 4:8732866-8732888 CATCTGGGCATTGCAGCCACTGG + Intergenic
971994893 4:33953395-33953417 CAACCCAGCAATCCTGTCACTGG - Intergenic
972406103 4:38748007-38748029 CAACCCATGAAAGCAGCCACAGG + Intergenic
973070240 4:45849548-45849570 GAAACCAACATTGCAGCCAAAGG - Intergenic
974309968 4:60192536-60192558 CAACCCAGCAATGCTGTTACTGG + Intergenic
974497228 4:62647517-62647539 CAACCCAGCAATCCCACCACTGG - Intergenic
974576370 4:63728848-63728870 CAACCCAGCACACCAGCCTCTGG - Intergenic
979805613 4:124966894-124966916 CATCCCAATATTGCAGCCAGTGG - Intergenic
981778105 4:148393697-148393719 CAACCCAACATTTCAGCATCAGG - Intronic
984041782 4:174744155-174744177 CAACCCAGCATTGCAGCCACTGG + Intronic
985491413 5:181859-181881 CAACCCACCATGTCGGCCACTGG - Intronic
986783212 5:11085943-11085965 CATCCCAGAATGGCAGCCACAGG + Intronic
987263712 5:16229447-16229469 CAACCCAGGACGGCAGCCAAGGG + Intergenic
987601621 5:20079219-20079241 CAACCCCACACTGCAGCCCCTGG + Intronic
989068710 5:37489171-37489193 CAGCCCAACATTGCCACCACTGG - Intronic
989571577 5:42951051-42951073 AACCCCAGCAGCGCAGCCACCGG + Intergenic
989765236 5:45075315-45075337 TAACCCAGAATTGCTGCCAGAGG - Intergenic
990397092 5:55393071-55393093 AAAACCAGTATGGCAGCCACTGG - Intronic
991013425 5:61907781-61907803 CAACCCAGCAATCCTACCACTGG + Intergenic
992345761 5:75876046-75876068 CAACCCAGCAATGCAATTACTGG + Intergenic
993637619 5:90364245-90364267 CAACCAAGCATTCCCACCACTGG + Intergenic
998382144 5:141733370-141733392 AAACCAAGGATTGCAGCCACCGG + Intergenic
998647476 5:144078780-144078802 CAACCTAACATTACAGCCAGAGG + Intergenic
999464137 5:151785547-151785569 CATCCCAGCATTTCATTCACGGG - Intronic
1000698526 5:164419464-164419486 CAACCCAACATTGCAACTAGAGG - Intergenic
1001375144 5:171249035-171249057 CATCCCACCATTGCCACCACTGG + Intronic
1003569885 6:7248778-7248800 CCACCAAGGACTGCAGCCACAGG + Exonic
1003869031 6:10387350-10387372 TAGCCCAGCATCGCAGTCACAGG + Intergenic
1004608049 6:17212521-17212543 AAACCCAGCATTTAGGCCACGGG + Intergenic
1008560097 6:52715281-52715303 CAACCAAGGATTCCATCCACTGG + Intergenic
1011357915 6:86491566-86491588 CAACCCAGAATTGAATCCACTGG - Intergenic
1013311682 6:108900537-108900559 CAAACCAGCTTGGTAGCCACAGG + Intronic
1013643700 6:112113884-112113906 GACCCCAGCATTCCAGCCAGTGG - Intronic
1014089352 6:117385741-117385763 CTACCCAGCATTGCAGGAGCAGG - Exonic
1017296560 6:152802601-152802623 CAACCCAGCAGTGCCACTACTGG - Intergenic
1018643452 6:165926615-165926637 CAAGCCAGGCTTCCAGCCACTGG + Intronic
1019104427 6:169656928-169656950 TCAGCCAGCATTGCAGCCTCTGG - Intronic
1021225626 7:18022530-18022552 CATCTCAGCATTTCAGCCTCTGG + Intergenic
1024528996 7:50375009-50375031 CAACCCAGAGTTGCAGGCTCAGG - Intronic
1026292271 7:69018424-69018446 CAACCCACGACAGCAGCCACAGG - Intergenic
1026404809 7:70054202-70054224 CTACCCAGTATGGTAGCCACTGG - Intronic
1026988937 7:74572114-74572136 CATCCCACCATAGCACCCACTGG - Intronic
1028329377 7:89570073-89570095 CAACCCAGAAATCCTGCCACTGG + Intergenic
1030963163 7:115952871-115952893 CCACTCAGCAAGGCAGCCACAGG + Intronic
1031544490 7:123034892-123034914 GAACCCAGAATTGCAGGAACAGG - Intergenic
1032257609 7:130309741-130309763 CAACCCATCAGTACAGCCATGGG - Intronic
1033369551 7:140696194-140696216 CAACCCAGCCTTAAAGCCAGTGG + Intronic
1034965725 7:155389452-155389474 CATCCCAGCAAGGCAGCCCCAGG + Intronic
1035093696 7:156334761-156334783 CAACCCAGCACTGCAGTTACAGG + Intergenic
1037945282 8:22985881-22985903 CTACCCACCAGTGCACCCACAGG + Intronic
1045272965 8:100677523-100677545 CAAGCCAGCATTGGAGCCCAGGG - Intergenic
1045749148 8:105460493-105460515 CATTCCAGCATCGCAGGCACGGG + Intronic
1047316137 8:123735132-123735154 AAACCCAGCATTATAGCCATTGG + Intronic
1048028133 8:130605560-130605582 CAACCCAGCACCACAGACACAGG - Intergenic
1049774103 8:144396814-144396836 CGCCCCAGCAGTCCAGCCACTGG + Intronic
1053181239 9:35972220-35972242 CACCCCAGCACTGCAGGCAGCGG - Intergenic
1056089605 9:83192182-83192204 CAACCCAGCAATCCCACCACTGG + Intergenic
1056399541 9:86213138-86213160 CAACCCAACTCTGCAGACACTGG - Intergenic
1056664196 9:88568147-88568169 TAGCCCAGCACTGCAGCCACAGG + Intronic
1058953302 9:109923509-109923531 CAACACAGCACTGCCTCCACTGG - Intronic
1060222814 9:121773459-121773481 CAGCCCAGAACTGAAGCCACGGG + Exonic
1061421405 9:130474696-130474718 CCAGCCAGCATCACAGCCACAGG - Intronic
1061757581 9:132826232-132826254 CAGCCCAGCTGTGCAGCCTCTGG - Intronic
1061882082 9:133573657-133573679 CAACTCAGCCTTGGAGCCGCAGG + Intronic
1062647502 9:137556372-137556394 CCACCCAGCCTTGCAGCCCCTGG - Intronic
1185926677 X:4154888-4154910 CAAACCAGCATTGCATCCCAGGG + Intergenic
1185993193 X:4914785-4914807 CAACCCAGCAATGCCACCACTGG + Intergenic
1186262257 X:7791930-7791952 CCACCCCTCAGTGCAGCCACTGG + Intergenic
1188063970 X:25634157-25634179 CAGCCCACCATTGCTACCACTGG + Intergenic
1188163338 X:26829708-26829730 CATCCCCCCAATGCAGCCACAGG - Intergenic
1192047405 X:67690440-67690462 CATCCCAGCATTGCTACCTCAGG + Intronic
1194093325 X:89604061-89604083 CAACCCATGAGAGCAGCCACAGG + Intergenic
1194434034 X:93848559-93848581 CAGCCCACCACTGCAACCACAGG - Intergenic
1195221209 X:102746428-102746450 CAAGCCAGCTTTGCAGGCGCCGG + Intronic
1195843488 X:109201017-109201039 CCATCCAGCATGGTAGCCACTGG - Intergenic
1198721645 X:139628102-139628124 CAACCCAGCATTGCCATTACTGG + Intronic
1200075091 X:153546857-153546879 CAACCCAGGGCTGCAGCCATCGG - Intronic
1201144002 Y:11052780-11052802 CAACCCAGCACCCCAGCCTCCGG + Intergenic