ID: 984041993

View in Genome Browser
Species Human (GRCh38)
Location 4:174746479-174746501
Sequence ATACCAGGGACTGGGGAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 902
Summary {0: 1, 1: 0, 2: 3, 3: 84, 4: 814}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984041993 Original CRISPR ATACCAGGGACTGGGGAGAC CGG Intronic
900171076 1:1269146-1269168 ACACCCGAGACTGGGGAGAGGGG + Intronic
900171098 1:1269225-1269247 ACACCCGAGACTGGGGAGAGGGG + Intronic
900171119 1:1269304-1269326 ACACCCGAGACTGGGGAGAGGGG + Intronic
900171141 1:1269383-1269405 ACACCTGAGACTGGGGAGAGGGG + Intronic
900560450 1:3303230-3303252 TTACCAGGGGCTGGGGGGAGAGG - Intronic
901307906 1:8246528-8246550 CTGCCAGGGGCTGGGGAGAATGG + Intergenic
901416621 1:9120964-9120986 ATGCCACTGCCTGGGGAGACGGG + Intronic
901672083 1:10861943-10861965 ATCCCAGGGCCAGGGGACACTGG - Intergenic
902136901 1:14314836-14314858 TTTCCAGGGACTGGGGAGAAGGG - Intergenic
902295325 1:15463134-15463156 ATGCCAGGTCCTGGGGACACAGG + Intronic
902652648 1:17846559-17846581 TTCCCAGGCACTGGGGAGAGTGG - Intergenic
903218195 1:21854607-21854629 ATACCTGGGTGTGGGGAGGCAGG + Exonic
903229521 1:21913403-21913425 ATCCCAGGGACTCGGGTTACCGG + Intronic
903349154 1:22707714-22707736 ATACCAGGCACTGAGGAGGCAGG - Intergenic
903611052 1:24613051-24613073 CTGCCAGGGGCTGGGGAGAGAGG - Intergenic
903726145 1:25446891-25446913 ATACCAGGGACTGGTATGTCTGG + Exonic
904042738 1:27593705-27593727 ATAGCAGGGATTGGTGAGATAGG - Intronic
904123807 1:28222062-28222084 TTACCAGGGGCTGGGGAGGGAGG + Intronic
904125280 1:28233930-28233952 TTTTCAGGGACTGGGGAGAGGGG - Intergenic
904353121 1:29921887-29921909 CTGCCAGGGACTGGGAAGGCAGG - Intergenic
904425831 1:30422416-30422438 AGGCCAGGGACTGAGGAGAGAGG + Intergenic
904489798 1:30851562-30851584 GTACTAGGAACTGGGGATACAGG + Intergenic
904650454 1:32001908-32001930 ATCCCAGCTACTGGGGAGGCTGG - Intergenic
905383747 1:37584329-37584351 ATCCCAGCTACTGGGGAGACTGG + Intronic
905462787 1:38132419-38132441 ACACCAGAGACTGAGGAGGCAGG + Intergenic
905505923 1:38479577-38479599 CTGCCAGGGGCTGGGGAGAAGGG + Intergenic
906087291 1:43147214-43147236 ATGCCAGGGGCTGGAGAGAAGGG + Intronic
906214892 1:44033002-44033024 ATTCCTGGGACTGGGCAGATGGG + Intergenic
906342623 1:44994047-44994069 ATGCTAGGTCCTGGGGAGACAGG - Intergenic
906711560 1:47934231-47934253 GAACCAGAGACTGGGGAGTCAGG - Intronic
906818439 1:48903437-48903459 ATCCCAGGGACTGGGGAGTCAGG - Intronic
907033842 1:51198923-51198945 ATCCCAGCTACTTGGGAGACAGG - Intergenic
907315718 1:53570372-53570394 ATACCAGCTACTTGTGAGACTGG - Intronic
908071294 1:60463312-60463334 TCACCAGGGACTGGGGAAAGAGG - Intergenic
908172460 1:61519652-61519674 TTACCAGGGGCTGGAGAGGCGGG - Intergenic
908522367 1:64956671-64956693 ATTCAAGGCACTGGGGACACTGG - Intronic
910870484 1:91828820-91828842 ATGCCAGGGAATTGGGAGAGAGG - Intronic
911042190 1:93599785-93599807 ATGCCAGTGACTGGGGAAAAGGG - Intronic
911313712 1:96329836-96329858 AAATGAGGGACTGGGGAGAAGGG - Intergenic
911630870 1:100181904-100181926 TTACCAGAGACTTGGGAGAGGGG - Intergenic
913240951 1:116828865-116828887 ATCCCAGCTACTTGGGAGACAGG - Intergenic
913583440 1:120249682-120249704 ATCCCAGCTACTGGGGAGGCTGG + Intergenic
913624734 1:120648640-120648662 ATCCCAGCTACTGGGGAGGCTGG - Intergenic
914565427 1:148861518-148861540 ATCCCAGCTACTGGGGAGGCTGG + Intronic
914607398 1:149268730-149268752 ATCCCAGCTACTGGGGAGGCTGG - Intergenic
914845139 1:151279632-151279654 ATCCCAGCTACTGGGGAGGCTGG - Intergenic
915239066 1:154506972-154506994 AGACCAGGGCATGGTGAGACAGG - Intronic
915561369 1:156690089-156690111 ATGCCAGGGACTGGGCTGGCTGG + Intergenic
916086753 1:161275911-161275933 ATCCCAGCTACTGGGGAGGCTGG - Intronic
917174911 1:172223231-172223253 ATACCAGAGACTGGAGAGGTGGG - Intronic
917281733 1:173383745-173383767 AAACCAGGGACTGGGACCACAGG + Intergenic
917430113 1:174957667-174957689 ATCCCAGCTACTTGGGAGACTGG - Intronic
918602120 1:186375776-186375798 AAGCCAGGGACTTGGGAGTCAGG - Intronic
919744887 1:201002470-201002492 AAACCTGGGGCAGGGGAGACTGG - Intronic
919905761 1:202077273-202077295 ATCCCAGCTACTTGGGAGACTGG + Intergenic
920030789 1:203036343-203036365 AGAGCAGGGACTCAGGAGACTGG - Intronic
920270286 1:204757654-204757676 ATCCCAGGTACTTGGGAGGCTGG + Intergenic
920860788 1:209704822-209704844 ACATCAGGGACGGGGGAGGCTGG - Intronic
920867981 1:209769069-209769091 ATACTATGGAATGGGGAGAGAGG + Intronic
921218547 1:212957030-212957052 TTGCCAGGGGCTGGGGAGAGAGG - Intronic
921342830 1:214151764-214151786 TTGCCAGGGGCTGGGGAGAGAGG + Intergenic
922287978 1:224185616-224185638 ATCCCAGGTACTCGGGAGACTGG - Intronic
922590322 1:226770869-226770891 ATCCCAGCTACTTGGGAGACAGG - Intergenic
922911265 1:229219720-229219742 TTGTCAGGGACTGGGGAGAGTGG + Intergenic
923177141 1:231477709-231477731 TTGCCAGGGACTGGGGAGAGGGG + Intergenic
923546236 1:234925492-234925514 AGACCAGGGACAGGGGAGGAGGG - Intergenic
924112993 1:240718124-240718146 ATCCCAGCTACTGGGGAGGCTGG - Intergenic
924167487 1:241299995-241300017 ATACCAGCCACTCGGGAGGCTGG + Intronic
924314514 1:242782009-242782031 ATCCCAGCTACTCGGGAGACCGG + Intergenic
924600603 1:245485499-245485521 ATCCCAGGTACTTGGGAGGCTGG - Intronic
1062774114 10:131124-131146 AAAACAGGGACCAGGGAGACAGG + Intergenic
1063538866 10:6911882-6911904 ATCCCAGGTACTCGGGAGGCTGG - Intergenic
1063877268 10:10493261-10493283 TTGCCAGGGTCTGGGGAGAGGGG + Intergenic
1063902428 10:10748053-10748075 ATACCAGAGGCTGGGAAGGCTGG + Intergenic
1063921934 10:10941874-10941896 ATCCCAGCCACTGGGGAGGCTGG + Intergenic
1064106970 10:12508475-12508497 TTACCAGGGACTGGGGGGAAGGG + Intronic
1064217419 10:13411979-13412001 ACACCAGGGACTGAGGGGAGGGG - Intergenic
1064318444 10:14279302-14279324 ATCCCAGCTACTGGGGAGGCAGG - Intronic
1064568715 10:16670880-16670902 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1064619299 10:17198627-17198649 TTACCAGGGACTGGGGGGAAAGG + Intronic
1065182676 10:23142724-23142746 ATAACAGATACTGGGGACACAGG + Intergenic
1065194758 10:23253134-23253156 ATACCTGAGACTGGGAAGAAGGG - Intergenic
1065242404 10:23720003-23720025 TTGCCAGGGCCTGGGGAGAAGGG + Intronic
1065309893 10:24404959-24404981 ATGCCAGGGACTGGGGATGTAGG + Intronic
1065543672 10:26796802-26796824 TTTCCACGCACTGGGGAGACAGG + Intronic
1065779896 10:29157570-29157592 ATACCAGGGCCCTGGGACACAGG + Intergenic
1067016313 10:42758364-42758386 AAAGCAGGGACTGGGGAGAAGGG + Intergenic
1067407707 10:46038100-46038122 TTGCCAGGGGCTGGGGAGAAGGG + Intronic
1067717554 10:48701088-48701110 TTCCCAGAGACTGGGGAGAGGGG - Intronic
1068354664 10:55896414-55896436 ATACCTGAGACTGGGAAGAAAGG + Intergenic
1069480881 10:68781112-68781134 ATACCAGCTACTCGGGAGGCTGG + Intronic
1069916377 10:71789570-71789592 GGAACAGGGGCTGGGGAGACTGG - Intronic
1070002915 10:72394506-72394528 ATCCCAGCTACTGGGGAGGCTGG + Intronic
1070691219 10:78527881-78527903 TTACCAGGGGCTGGGGAGAGGGG - Intergenic
1070838492 10:79467039-79467061 ATGCCAGGGGCTGGGGAGGGTGG + Intergenic
1071054573 10:81494061-81494083 TTACTAGGGACTGGGGAGGGGGG + Intergenic
1071662999 10:87524717-87524739 ATCTCAGGGAATAGGGAGACTGG + Intronic
1071669790 10:87597717-87597739 AAATGAGGGACTAGGGAGACAGG - Intergenic
1071729041 10:88229674-88229696 TTGCCAGAGACTGGGGAGAGAGG - Intergenic
1071823367 10:89300251-89300273 ATACCAGAGACTGGGAAGGGGGG + Intronic
1072081807 10:92040241-92040263 ATCCCAGCTACTGGGGAGGCTGG + Intergenic
1072676725 10:97472353-97472375 ATCCCAGCCACTCGGGAGACAGG - Intronic
1072737504 10:97889102-97889124 ATACCAGGGGCAGTGGAGGCGGG + Intronic
1072767472 10:98107413-98107435 TTGCCAGGGGCTGGGGAGAGAGG - Intergenic
1073000858 10:100285377-100285399 ATCCCAGCTACTGGGGAGACTGG - Intronic
1073203023 10:101751601-101751623 TTGCCAGGGGCTGGGGAGCCAGG + Intergenic
1074077269 10:110140551-110140573 ATCCCAGCTACTTGGGAGACAGG - Intergenic
1074405633 10:113178209-113178231 AAACCTGGGACTGGGCACACAGG - Intergenic
1074499512 10:114010949-114010971 TTAGCAGGGGCTGGGGAGAGGGG - Intergenic
1075920413 10:126207227-126207249 AAACAATGGAATGGGGAGACAGG + Intronic
1076218684 10:128716006-128716028 ATGCCAGGGACTGGGAAGCCGGG - Intergenic
1076304110 10:129451394-129451416 TTGCCAGGGGCTGGGGAGAAGGG + Intergenic
1076511501 10:131017444-131017466 CTACCACAGACTGGGGAGGCAGG + Intergenic
1076573175 10:131445814-131445836 ATAACATGGGGTGGGGAGACGGG + Intergenic
1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG + Intronic
1076773816 10:132682020-132682042 TTGCCAGGGGCTGGGGAGAGCGG + Intronic
1077600314 11:3570105-3570127 TTAGCAGGGACTGGGGGGACTGG + Intergenic
1077637356 11:3852557-3852579 TTGCCAGAGACTGGGGAGAGGGG - Intergenic
1077671099 11:4158245-4158267 TTGCCAGGGACTAGGGAGAGGGG - Intergenic
1077791923 11:5450269-5450291 ATTCCAGCTACTGGGGAGGCTGG + Intronic
1077890025 11:6411877-6411899 ATACTAGGGACTGTGAGGACAGG + Intronic
1078245670 11:9572187-9572209 ATACCAGCTACCCGGGAGACAGG + Intergenic
1078689927 11:13569576-13569598 TTACCAGGGGCTGGACAGACGGG + Intergenic
1079231203 11:18650267-18650289 AAAGCAGGGACTGAGGAGAATGG + Intergenic
1080827426 11:35860012-35860034 ATCCCAGCTACTTGGGAGACTGG - Intergenic
1081517132 11:43843841-43843863 ATACATGGAAGTGGGGAGACAGG - Intronic
1081881331 11:46455334-46455356 TGACCAGGGACTGGGGAGAGAGG - Intronic
1082013761 11:47469201-47469223 TGACCAGGGAGTGGGGAGAGAGG - Intronic
1082126616 11:48439339-48439361 TTACCAGGGACTGGGGAAAAGGG - Intergenic
1082560188 11:54610286-54610308 TTACCAGGGACTGGGGAAAAGGG - Intergenic
1082983171 11:59142910-59142932 ATACTCGGGACTGGGGAAACCGG + Exonic
1084035276 11:66506064-66506086 ATACCAGCTACTCGGGAGACTGG - Intronic
1084130274 11:67128268-67128290 ATCCCAGGAGCTGGGGAGGCTGG - Intronic
1084158469 11:67329888-67329910 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1084196619 11:67526323-67526345 ATACCAGCTACTCGGGAGGCTGG + Intergenic
1084485843 11:69447680-69447702 ATCCCAGGCAGTGGGGACACAGG - Intergenic
1084571163 11:69960791-69960813 ATACTAGGCAGTGGGGGGACAGG - Intergenic
1084617752 11:70247698-70247720 ATACCAGGTGCTGAGGACACAGG - Intergenic
1084841926 11:71859820-71859842 TTTCCAGGGACTGGGGAGGGAGG + Intergenic
1085909420 11:80803762-80803784 ATACCAGGGGATGGGGAGCTAGG + Intergenic
1086154790 11:83653838-83653860 ATACCAGCTACTCGGGAGGCTGG - Intronic
1086235655 11:84626987-84627009 ATCCCAGCTACTAGGGAGACTGG - Intronic
1086426138 11:86684301-86684323 TTACCAGGAACTTTGGAGACAGG + Intergenic
1086622964 11:88910078-88910100 CTACCAGGGACTGGGGAAGTGGG - Intronic
1086955913 11:92934375-92934397 AGAGAAGGGACTGGGGAGAAAGG + Intergenic
1086969662 11:93066727-93066749 ATACCCGAGACTGGGAAGAAAGG + Intergenic
1086984771 11:93235917-93235939 TTCCCAGGGACTGGGAAGGCTGG - Intergenic
1087580410 11:100044054-100044076 ACACCAGAGACTGGGAAGAGTGG - Intronic
1088048074 11:105477832-105477854 ATCCCAGGTACTCGGGAGGCTGG - Intergenic
1088484477 11:110327671-110327693 TTGCCAGGGGCTGGGGAGAGGGG + Intergenic
1088622962 11:111705580-111705602 AGAGCAGGGACAGGGGAGAGAGG + Intronic
1089383815 11:118055194-118055216 ATACCAGAGACATGGGAGGCAGG - Intergenic
1089475806 11:118760701-118760723 ATCCCAGGTACTCGGGAGGCTGG + Intronic
1089517397 11:119041998-119042020 ATACCAGTGTTTGGGGAGGCAGG - Intergenic
1089544110 11:119209499-119209521 ATCCCAGCTACTTGGGAGACTGG + Intronic
1089727882 11:120498795-120498817 TTGCCAGGGACTGGGGAGAGGGG + Intergenic
1090480994 11:127068008-127068030 CTACCAGGCACTGGGGACACAGG - Intergenic
1090539805 11:127688758-127688780 TTACCAGGGGCTGAGGAGAGGGG - Intergenic
1090669859 11:128938589-128938611 AGAACAGGGACGGGGAAGACTGG - Intronic
1091015903 11:132050524-132050546 TTACCATGAAGTGGGGAGACAGG + Intronic
1091044731 11:132315529-132315551 ACATGAGGGATTGGGGAGACAGG - Intronic
1091405415 12:206241-206263 CTACCAGGGGCTGGGGAGAGAGG - Intronic
1091522895 12:1265730-1265752 AGATCACGGACTGGGGAGACGGG - Intronic
1091864800 12:3823244-3823266 ATACCAGGGACTGGAGTGGGAGG - Intronic
1093516443 12:19992332-19992354 ATGACAGGGAATGGGGAGAGTGG - Intergenic
1093715333 12:22375694-22375716 ATCCCAGGGACAGGAGAGGCCGG - Intronic
1094802533 12:34053282-34053304 ATACAATGGACTTTGGAGACGGG + Intergenic
1095290420 12:40473200-40473222 ACATCAGGTACTGGGGACACTGG + Exonic
1095458331 12:42414150-42414172 ATCCCAGCTACTCGGGAGACAGG - Intronic
1095473899 12:42565767-42565789 ATCCCAGAGGCTGGTGAGACAGG + Intronic
1095923085 12:47550666-47550688 TTTCCAGGGACTAGGGAGAGGGG + Intergenic
1095956420 12:47808904-47808926 ATCTCAGGGACTGGAGATACTGG - Intronic
1096654299 12:53079137-53079159 AGTGCAGGGCCTGGGGAGACTGG - Intronic
1096949844 12:55456565-55456587 ATGCCAGGTACTAGGGAGGCTGG - Intergenic
1097058595 12:56266105-56266127 ATCCCAGGTACTGGGGAGGGGGG + Intergenic
1097232625 12:57521860-57521882 CTGCCCTGGACTGGGGAGACCGG + Intronic
1097287888 12:57891682-57891704 TTACCAGGAGCTGGGGAGAGGGG - Intergenic
1098253628 12:68594256-68594278 ATACCAGCCACTCGGGAGGCTGG - Intergenic
1098539936 12:71643293-71643315 ATCCCAGCTACTCGGGAGACTGG + Intronic
1098558685 12:71848199-71848221 ATACCTGGGAATGGGGTGGCTGG + Intronic
1098857012 12:75664495-75664517 TTGCCAGGGACTGGAGAGAGGGG - Intergenic
1100047743 12:90404246-90404268 TTACCAGGGGCTGGGGAAAAGGG + Intergenic
1100303721 12:93331574-93331596 GTACCAGGTGCTGGGGAAACAGG - Intergenic
1100813850 12:98366555-98366577 ATCCCAGCTACTCGGGAGACTGG + Intergenic
1101190073 12:102323538-102323560 GTCCCAGCTACTGGGGAGACAGG + Intergenic
1101275875 12:103200312-103200334 TTGCCAGTGACTGGGGAAACAGG + Intergenic
1101381576 12:104217741-104217763 ATACCAGGGGCTGGGGGAAACGG - Intronic
1101426036 12:104589454-104589476 TTACCAGGGACAAGAGAGACGGG + Intronic
1101695722 12:107124123-107124145 TTACCAGAGGCTGGGGAGAGGGG + Intergenic
1101912306 12:108869270-108869292 AGACCAGGGACTCTGGAGTCAGG - Intronic
1101928805 12:108995483-108995505 TTACCAGGGGCTGGGGGGAAGGG + Intronic
1102100599 12:110275568-110275590 ATCCCAGCTACTGGGGAGGCTGG - Intergenic
1102218473 12:111178666-111178688 ATGCCAGGGGCTGGGTACACAGG + Intronic
1102429526 12:112871353-112871375 TTACCAGGGGCTGGGCAGAGAGG - Intronic
1102483101 12:113237472-113237494 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1102835579 12:116055774-116055796 ATCCCAGCTACTGGGGAGGCTGG + Intronic
1103421005 12:120782476-120782498 ATACCTGGGGCTGGGGAGGTGGG + Intronic
1103496923 12:121370161-121370183 TTGCCAGGGGCTGGGGAGAGGGG - Intronic
1105060856 12:133149209-133149231 GTCCCAGCTACTGGGGAGACAGG - Intronic
1105402496 13:20108286-20108308 ATCCCAGCTACTGGGGAGGCTGG - Intergenic
1105535098 13:21258542-21258564 ATCCCAGCTACTGGGGAGGCTGG + Intergenic
1106353907 13:28960684-28960706 TTTCCAGGGACTGGGGAGAAAGG + Intronic
1106368598 13:29108619-29108641 CTTGCAGGGAATGGGGAGACAGG + Intronic
1106438007 13:29740695-29740717 ATCCCAGCTACTGGGGAGGCTGG + Intergenic
1106675557 13:31954374-31954396 ATCCCAGCTACTCGGGAGACAGG + Intergenic
1106689689 13:32101122-32101144 TTACCAGGGGCTGGCGAGAGAGG - Intronic
1108504926 13:51103864-51103886 CTACCATGGACTGGGGAAAGGGG + Intergenic
1109627431 13:64993870-64993892 ATACCAGTGGGTGGGGAGAGAGG - Intergenic
1110770591 13:79339244-79339266 TTACCAGGGGCTGTGGGGACAGG + Intronic
1111105270 13:83637426-83637448 ATCCCAGCAACTTGGGAGACTGG + Intergenic
1111212969 13:85104667-85104689 TTACCAGTGACTGGGGAAAGAGG + Intergenic
1111336315 13:86828837-86828859 TTACCAGGGACTTGGGAGTCAGG - Intergenic
1111502748 13:89144307-89144329 TTGCCAGGGACTGGGGAGGAGGG - Intergenic
1111633006 13:90867164-90867186 ATCCCAGCTACTCGGGAGACAGG + Intergenic
1112178818 13:97055966-97055988 TTACCAGGGGCTGGGGAAATGGG + Intergenic
1112249188 13:97763432-97763454 TTGCCAGGGAGTGGGGAGATAGG + Intergenic
1112451536 13:99515848-99515870 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1112503423 13:99958871-99958893 ATACGAGGGACTGCGGTGAGGGG - Intergenic
1112641678 13:101282488-101282510 TTACCAGGGGCTGGGGACAGGGG + Intronic
1112720085 13:102234028-102234050 TTGCCAGGGACTGGGGAAAGTGG + Intronic
1113294507 13:108943567-108943589 ATCCCAGCGACTTGGGAGGCAGG - Intronic
1113482225 13:110629471-110629493 CTGCCAGGAACTGGGGAGACTGG - Intronic
1113626054 13:111847511-111847533 TTACCAGGGACTGGGGTGGAGGG - Intergenic
1114055443 14:18964184-18964206 GTACCAGAGGCTGGGAAGACTGG + Intergenic
1114069135 14:19094412-19094434 AAAGCAGGGACTGGGGAGGAGGG - Intergenic
1114093125 14:19305591-19305613 AAAGCAGGGACTGGGGAGGAGGG + Intergenic
1114623814 14:24115486-24115508 ATACCAGGGTCTCCTGAGACGGG - Exonic
1115292718 14:31790891-31790913 TTATCAGGGGCTGGGGAGAATGG - Intronic
1116983395 14:51194559-51194581 ATCCCAGGTACTCGGGAGGCTGG + Intergenic
1117102375 14:52363753-52363775 ATCCCAGCTACTGGGGAGGCTGG - Intergenic
1117168241 14:53061914-53061936 ATCCCAGCTACTGGGGAGACAGG + Intronic
1117903087 14:60555712-60555734 GTACCAGAAACTGGGGAGAAAGG + Intergenic
1118351098 14:64972672-64972694 GTACCAGCCACTGGGGAGCCCGG - Intronic
1118799829 14:69179606-69179628 TTGCCAGGGACTGGGGGGAGGGG - Intergenic
1118959284 14:70514079-70514101 AATGCAGAGACTGGGGAGACAGG - Intergenic
1119251439 14:73158441-73158463 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1119781194 14:77277825-77277847 AGGCCAGGGACTGGGGAAGCGGG + Intronic
1120253598 14:82090411-82090433 ATACCTGAGACTGGTGAGACTGG + Intergenic
1120779262 14:88471470-88471492 ATACATGGGACTGGGAAGACTGG + Intronic
1121163845 14:91772596-91772618 ATAGCAGGGATTGGAGAGAGAGG + Intronic
1121230930 14:92357675-92357697 TTGCCAGGGACTGGGGCGATGGG + Intronic
1121354052 14:93198566-93198588 ATCCCAGCTACTAGGGAGACAGG - Intronic
1122017029 14:98804971-98804993 GTACCAGGGGCTGGTGAGAGGGG + Intergenic
1122051022 14:99059995-99060017 ATACCAGTTACAGGGAAGACTGG - Intergenic
1122868657 14:104623215-104623237 ATCCCAGGTACTAGGGAGGCTGG - Intergenic
1123879381 15:24661626-24661648 TTACCAGAGGCTGGGGAGTCTGG - Intergenic
1124094705 15:26638298-26638320 ATCACAGAGACTGGGCAGACAGG - Intronic
1124479845 15:30068705-30068727 CTCCCAGGGACTGGGGAGTAGGG - Intergenic
1125443827 15:39732008-39732030 ATTCCATGGACTGGGGGGAATGG + Intronic
1125510425 15:40289711-40289733 ATATCAGGGCCAGGGGAGGCTGG - Intronic
1125616188 15:41015827-41015849 ATCCCAGCTACTCGGGAGACTGG + Intronic
1125807260 15:42504222-42504244 ATCCCAGCTACTCGGGAGACTGG + Intronic
1126442580 15:48706551-48706573 TTACCAGAGACTGGGGATAGGGG - Intergenic
1126466411 15:48964971-48964993 ATCCCTGGGGCTGAGGAGACAGG + Intergenic
1127137666 15:55941679-55941701 ATACCAGCTACTTGGGAGACTGG - Intronic
1127176096 15:56359371-56359393 TTACCAGGGACTAGGGAGAGAGG - Intronic
1127873898 15:63096429-63096451 ATCCCAGCTACTTGGGAGACTGG - Intergenic
1128006614 15:64248551-64248573 ATGGCAGGGAGTGGGGAGAGTGG + Intronic
1128081347 15:64858930-64858952 TTGCCAGGGGCTGGGGAGAGGGG - Intronic
1128330641 15:66753322-66753344 ATCCCTGCGACTGGGGTGACAGG - Intronic
1128759979 15:70209976-70209998 ATTCCAGGCACTGGGGATGCAGG - Intergenic
1128880554 15:71238477-71238499 TTTCCAGGGATTGGGGAGAGAGG - Intronic
1129190887 15:73937023-73937045 AGAAAGGGGACTGGGGAGACTGG + Intronic
1129447901 15:75631672-75631694 ATCGCAGGTACTGGGGAGGCTGG + Intergenic
1129894953 15:79096880-79096902 TTGCCAGGGACTGGGGAGAAGGG - Intergenic
1130084037 15:80762306-80762328 ATGCCAGGGGCTTGGGTGACAGG - Intergenic
1130534841 15:84776932-84776954 ATCCCAGCTACTCGGGAGACTGG + Intronic
1130940369 15:88503144-88503166 ATCCCAGCTACTTGGGAGACTGG + Intergenic
1131359081 15:91773328-91773350 TTGCCAGGGTCTGGGGAGAGGGG + Intergenic
1131721383 15:95172307-95172329 ATCCCAGCTACTCGGGAGACTGG + Intergenic
1132039527 15:98513253-98513275 ATCCCAGGTACTTGGGAGGCTGG + Intronic
1132284562 15:100652978-100653000 AGACCAAGCACTGGGGAAACAGG - Intergenic
1132424426 15:101702650-101702672 ATCCCAGCTACTTGGGAGACTGG + Intronic
1132904939 16:2277755-2277777 GTCCCAGGGATTGGGGAGATGGG + Intronic
1133105189 16:3503090-3503112 ATTCCAGTTACTGGGGAGGCTGG - Intronic
1133667894 16:7987698-7987720 ATCCCAGCAACTGGGGAGGCAGG + Intergenic
1134027429 16:10965042-10965064 TTACCAGGGACTGGGGAGGAGGG - Intronic
1134506971 16:14815667-14815689 ATCCCAGCTACTTGGGAGACAGG - Intronic
1134573590 16:15313159-15313181 ATCCCAGCTACTTGGGAGACAGG + Intergenic
1134586984 16:15420124-15420146 ATCCCAGCTACTTGGGAGACAGG + Intronic
1134642117 16:15837650-15837672 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1134728835 16:16443156-16443178 ATCCCAGCTACTTGGGAGACAGG - Intergenic
1134938607 16:18268768-18268790 ATCCCAGCTACTTGGGAGACAGG + Intergenic
1135244336 16:20842199-20842221 TTACCAGGGGCTGGGGGGAGGGG - Intronic
1135562172 16:23485213-23485235 TTGCCAGGGACTGGGGAAAGGGG + Intronic
1136004438 16:27318957-27318979 GTGCCAGGGGCTGGGGACACGGG + Intronic
1136347093 16:29683140-29683162 ATCCCAGCTACTCGGGAGACTGG - Intronic
1138189871 16:55005980-55006002 TTACCAGGGCCTGGGGAAAGGGG + Intergenic
1138639082 16:58368560-58368582 TTGCCAGGGGCTGGGGAGAGGGG - Intronic
1139098318 16:63733169-63733191 ATACCAGGGAATAGGAATACAGG + Intergenic
1139164724 16:64552606-64552628 CTCCCAGGGACTGGAGAGAGGGG - Intergenic
1139461155 16:67123457-67123479 ATCCCAGCTACTGGGGAGGCTGG + Intronic
1139627891 16:68206403-68206425 TTACCAGGGGCTGGGAGGACGGG - Intronic
1140298706 16:73735417-73735439 TTACCAAGGACTGGGGAGAGGGG - Intergenic
1140445691 16:75025864-75025886 ACACCAGGCAGTGGGGGGACGGG + Intronic
1140692562 16:77498611-77498633 ATTCCAGGTATTTGGGAGACTGG + Intergenic
1140707821 16:77647279-77647301 ATACCAGCCACTGAGGAGAAAGG - Intergenic
1140786982 16:78351772-78351794 ATCCCAGAGACTCGGGAGGCTGG - Intronic
1141136313 16:81468002-81468024 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1141190809 16:81823366-81823388 ATTTCAGGGACTGGCCAGACAGG - Intronic
1141247071 16:82317904-82317926 ATTCCAGGCACTGGGGATGCAGG - Intergenic
1141663771 16:85455266-85455288 ATCCCAGCTACTGGGGAGGCAGG + Intergenic
1141939968 16:87269080-87269102 GTACCTGGCCCTGGGGAGACAGG - Intronic
1141995010 16:87630843-87630865 ATAGCTGGGAGTGGGGAGAATGG - Intronic
1142028687 16:87827891-87827913 ATCCCAGCTACTTGGGAGACTGG - Intergenic
1143184165 17:5000506-5000528 CTCCCAGGGACTGGGAACACGGG - Intronic
1143497967 17:7323253-7323275 ATCCCAGGGACAGAGGAGATAGG - Intronic
1143797329 17:9347798-9347820 TTGCCAGGGACTGGGGAGTTGGG - Intronic
1143805474 17:9422456-9422478 ATGCCAGGAACTAGGGAGAGGGG - Intronic
1143819779 17:9550955-9550977 ATCCCAGGTACTTGGGAGGCTGG + Intronic
1143851433 17:9815028-9815050 ATCCTAGGCACTGGGGAGAAAGG + Intronic
1143871358 17:9959246-9959268 ATCCCAGGTTCTGGGGAGAGAGG + Exonic
1144079098 17:11746170-11746192 ATACCTGAGACTGGGTAGTCAGG + Intronic
1144582699 17:16468544-16468566 CTACCAGGGGCTGGGGGGAAGGG + Intronic
1144761851 17:17711498-17711520 CTGCCAGGGGCTGGGGAGGCTGG + Intronic
1145100157 17:20068496-20068518 ATACCAAGGACTGGAGTTACTGG + Intronic
1145106746 17:20124125-20124147 ATGTCAGGGAATGGGGAGAATGG + Intronic
1145221045 17:21088624-21088646 TTACCAGGGGCTGGAGAGATGGG + Intergenic
1146339878 17:32009379-32009401 ATCCCAGCTACTTGGGAGACTGG - Intronic
1146403602 17:32519262-32519284 ATGCCAGGCACTGGGCAGGCCGG + Intronic
1146657942 17:34645929-34645951 ATCCCAGCGATTGGGGAGAGAGG + Intergenic
1147168960 17:38607085-38607107 AGACCAGGAAGTGGGGAAACCGG - Intergenic
1147586182 17:41655132-41655154 ATGTCAGGGCCTGGGGAGGCTGG - Intergenic
1148083065 17:44978061-44978083 ACAGCAGGGACTGGGGAGGAGGG - Intergenic
1148782055 17:50128061-50128083 AGACTAGGGACTGTGAAGACAGG + Intronic
1149125337 17:53223574-53223596 TTACCAGGGGCTGGGGAAAGTGG + Intergenic
1149158550 17:53663717-53663739 ATACCAAGGACTGGGAGGAGGGG + Intergenic
1149536807 17:57439530-57439552 GTGCCAGGCACTGGGGAGATAGG + Intronic
1149615885 17:57998096-57998118 ATACCAGCTACTTGGGAGGCAGG + Intronic
1149771409 17:59324761-59324783 ATTCCAGTGACTGGAAAGACAGG + Intergenic
1149788449 17:59456254-59456276 ATACTTGGGACTGGAGAGACTGG + Intergenic
1149819462 17:59761018-59761040 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1150672362 17:67212201-67212223 ATCCCAGCTACTGGGGAGGCAGG + Intronic
1150908701 17:69365976-69365998 ATCCCAGGTACTTGGGAGGCTGG - Intergenic
1151223609 17:72632113-72632135 AGACCAGGGATGAGGGAGACTGG + Intergenic
1151295223 17:73180489-73180511 ATCCCAGCTACTGGGGAGGCAGG - Intergenic
1152167533 17:78720079-78720101 TTGCCAGGGGCTGGGGAGAGGGG + Intronic
1152286923 17:79418044-79418066 ATGCCAGGGGCTGGGGAGATAGG + Intronic
1152649595 17:81486199-81486221 AGGCCAGGGGCTGGGGAGAGAGG - Intergenic
1152685833 17:81693563-81693585 GTACCTGGGACTGCTGAGACAGG - Exonic
1153335800 18:3923232-3923254 ATACCCAGGACTGGTAAGACTGG - Intronic
1153345178 18:4018090-4018112 ATAGCAGGGACTGTGAAGATTGG + Intronic
1153358688 18:4168558-4168580 TTACCAAGGACTAGGGAGAAGGG - Intronic
1153432489 18:5033255-5033277 TTACCAGAGGCTGGGGAGAGGGG + Intergenic
1153937260 18:9939631-9939653 ATACCAGGGACAGGGAAAAAAGG - Intronic
1155037492 18:22037202-22037224 ATTCCAGCTACTTGGGAGACTGG + Intergenic
1155156936 18:23165527-23165549 TTGCCAGGGACTGGGGGGGCAGG - Intronic
1155268495 18:24116941-24116963 ATTCCAGCTACTTGGGAGACTGG - Intronic
1155644813 18:28064500-28064522 ATACCAGCCAGTGGGGAGAAAGG + Intronic
1155823834 18:30413480-30413502 TTACCAGAGACTGGGGAGGGAGG + Intergenic
1157102855 18:44745660-44745682 TTGCCAGGCACTGGGGAGGCAGG + Intronic
1157137751 18:45073749-45073771 TTTCCAGGGGCTGGGGAGATGGG - Intergenic
1158109320 18:53922792-53922814 TTGCCAGGGGCTGGGGAGAATGG + Intergenic
1158151067 18:54371152-54371174 TTACCAGGGACTAGGGAGAGGGG - Intronic
1158588977 18:58763809-58763831 CTACCAGGGACTGGGGGCCCGGG + Intergenic
1159188302 18:65008014-65008036 ATATCATAGTCTGGGGAGACAGG + Intergenic
1160197065 18:76764473-76764495 ATGCCAGGGGCTGGCGAGTCCGG - Intergenic
1160798593 19:956847-956869 ATCCCAGGTGCTGGGGAGGCCGG - Intronic
1160845503 19:1164368-1164390 ATGCCAGGGGCAGTGGAGACAGG + Intronic
1160845534 19:1164484-1164506 ATGCCAGGGGCAGTGGAGACAGG + Intronic
1160845561 19:1164584-1164606 ATGCCAGGGGCAGTGGAGACAGG + Intronic
1160845612 19:1164775-1164797 ATGCCAGGGGCAGTGGAGACAGG + Intronic
1161108006 19:2454173-2454195 ATCCCAGCTACTCGGGAGACGGG + Intronic
1161224491 19:3136718-3136740 CTCCCAGGGAATGGGGAGCCTGG + Intronic
1161322528 19:3647827-3647849 ATCCCAGCTACTGGGGAGGCTGG + Intronic
1161445359 19:4315727-4315749 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1162251052 19:9443991-9444013 ATACTAGCTACTGGGGAGGCTGG - Intergenic
1162369291 19:10269499-10269521 CTTCCAGGTACTGGGGACACAGG - Intergenic
1162638777 19:11990756-11990778 ATACAATGGACTGTGGGGACTGG + Intergenic
1162883460 19:13678062-13678084 ATCCCAGCTACTGGGGAGGCAGG - Intergenic
1162938524 19:13994148-13994170 GTACCAGGGACTGGGAAGGCAGG - Intronic
1163083694 19:14963286-14963308 TTACCAGGGACTGGGGAGCAGGG + Intronic
1163349630 19:16767803-16767825 TTGCCAGGGACTGGGGTGAAGGG - Intronic
1163381855 19:16974338-16974360 ATCCCAGCGACTAGGGAGGCTGG + Intronic
1163525358 19:17817675-17817697 ATCCCAGCTACTGGGGAGGCTGG + Intronic
1164737759 19:30554371-30554393 ATCCCAGCTACTTGGGAGACAGG - Intronic
1164823932 19:31270421-31270443 ATCCCAGGTACTTGGGAGGCAGG - Intergenic
1165095674 19:33408500-33408522 ATATCTGGGACTGTGGAGAGAGG + Intronic
1165279304 19:34782987-34783009 ATATCAGGCACTGGTGACACTGG + Intergenic
1165306771 19:35007438-35007460 ATCCCAGCTACTGGGGAGGCTGG + Intronic
1165333374 19:35153881-35153903 CCACCAGGGGCTGGGGAGAGAGG - Exonic
1166096368 19:40541854-40541876 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1166231350 19:41427243-41427265 ACCCCAGGGACTGGGGAACCAGG + Intronic
1167039198 19:47012498-47012520 ATCCCAGCTACTCGGGAGACTGG + Intergenic
1167084377 19:47299272-47299294 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1167326990 19:48832723-48832745 AAACCAGGGTCTGAGGAGAAAGG + Exonic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1167685162 19:50951388-50951410 ATCCCAGCTACTCGGGAGACTGG - Intronic
1167906305 19:52664000-52664022 ATTCCAGCTACTGGGGAGACAGG - Intronic
1168442553 19:56382519-56382541 GTCCCAGCTACTGGGGAGACTGG + Intronic
1168716255 19:58529546-58529568 TTTCCAGGGACTGAGGAGAGGGG - Intronic
927199139 2:20567752-20567774 CTCCCAGGGACTGGGGTGAAAGG - Intronic
927548520 2:23976457-23976479 ATACCCGAGACTGGGAAGAAAGG + Intronic
927758907 2:25732643-25732665 TTATCAGGGGCTGGGGAGTCAGG - Intergenic
927929732 2:27036474-27036496 GTTCCAGGAACTGAGGAGACCGG - Exonic
928558874 2:32457007-32457029 ATCCCAGGTACTTGGGAGACAGG - Intronic
928623482 2:33115330-33115352 TTGCCAGGGACAGGGGAGAGTGG + Intronic
928940298 2:36720666-36720688 TTTCCAGGGGCTGGGGAGCCAGG + Intronic
928967005 2:36986732-36986754 ATCCCAGCTACTCGGGAGACTGG - Intronic
929166061 2:38883330-38883352 TTACCAGGGGCTGGGGTGATGGG - Intronic
929186194 2:39097679-39097701 ATCCCAGCTACTGGGGAGGCTGG - Intronic
929201356 2:39240306-39240328 ATCCCAGGTACTCGGGAGGCAGG + Intergenic
929249625 2:39738444-39738466 ATCCCAGGTACTTGGGAGGCTGG + Intronic
929558552 2:42941078-42941100 ATGCCAGGGACTGGGCATAGTGG - Intergenic
929686004 2:44035496-44035518 ATCCCAGCTACTTGGGAGACTGG - Intergenic
929989486 2:46773410-46773432 ATCCCAGCTACTTGGGAGACTGG + Intergenic
930120054 2:47753255-47753277 ATCCCAGCTACTGGGAAGACTGG + Intronic
930634609 2:53790209-53790231 ATCCCAGCTACTGGGGAGGCTGG - Intronic
930976082 2:57463300-57463322 TTACCAGGGACTGGGGGCTCGGG - Intergenic
931735117 2:65186825-65186847 ATCCCAGCTACTTGGGAGACAGG - Intergenic
932660863 2:73650743-73650765 TTGCCAGGGACTGGGGAGAGAGG - Intergenic
932668135 2:73713742-73713764 TTGCCAGGGATTGGGGAGAGAGG - Intergenic
933645052 2:84805355-84805377 TTGCCAGGGGCTGGGGAGAGGGG + Intronic
933715510 2:85356761-85356783 ATTCCAGCTACTCGGGAGACTGG + Intronic
933740087 2:85526452-85526474 ATCCCAGCTACTCGGGAGACTGG - Intergenic
933776488 2:85774201-85774223 ATACCAGGGGCTGGGGACAGTGG - Intronic
933858147 2:86438337-86438359 ATTACAGGGAGTGGGGAGATTGG + Intergenic
933990537 2:87631064-87631086 TTGCCAGGGGCTGGGGAGAGGGG + Intergenic
934665764 2:96169091-96169113 CTGCCAGGGGCTGGGGAGAGAGG + Intergenic
935034485 2:99355728-99355750 ATCCCAGCTACTCGGGAGACTGG - Intronic
935126684 2:100230670-100230692 ATCCCAGGGACTGTGGTGGCAGG + Intergenic
935192479 2:100789992-100790014 ATCCCAGCTACTAGGGAGACTGG - Intergenic
935883998 2:107595896-107595918 ATACGAGGCACTGAAGAGACAGG + Intergenic
936303309 2:111319760-111319782 TTGCCAGGGGCTGGGGAGAGGGG - Intergenic
936459186 2:112699533-112699555 TTACCAGGGACTGGGGGGAGAGG - Intergenic
936987176 2:118322647-118322669 TTATCAGGGGCTGGGGAGAGAGG - Intergenic
937039436 2:118809440-118809462 ATCCCAGGTACTTGGGAGGCTGG - Intergenic
937059796 2:118972429-118972451 GAAGCAGGGACTTGGGAGACTGG + Intronic
937130633 2:119509815-119509837 TTACCAGGGGCTGGGGAAATGGG - Intronic
937316858 2:120937198-120937220 ATGCCAGGCACTGGGGATACGGG + Intronic
937830525 2:126416907-126416929 TTACCAGAGACTGGGGAGGGGGG + Intergenic
938199566 2:129361983-129362005 ACACCAGGGACTGTGCAGGCTGG + Intergenic
938617211 2:133012123-133012145 ATAACAGGTAGTGGGGAGAAGGG - Intronic
938908676 2:135864377-135864399 ATCCCAGCTACTGGGGAGGCTGG + Intronic
940542528 2:155039482-155039504 ATTCCAGCTACTCGGGAGACAGG + Intergenic
940881655 2:158953034-158953056 ATCCCAGCTACTCGGGAGACTGG - Intergenic
941574691 2:167215567-167215589 ATACCATGGACTGGGGACTTTGG - Intronic
941828485 2:169926469-169926491 ATCCCAGCTACTCGGGAGACTGG + Intronic
941987781 2:171525053-171525075 ATCCCAGCTACTGGGGAGGCTGG - Intronic
942117863 2:172746728-172746750 ATCCCAGCTACTGGGGAGGCTGG - Intronic
942122253 2:172789623-172789645 CTACCAGGGACTGGAGTGAAAGG - Intronic
943048675 2:182889638-182889660 TTACCAGAGACTGGGGAGGTGGG - Intergenic
943566378 2:189521808-189521830 AGACCATGGACTGGGGAGATAGG - Intergenic
944072576 2:195689721-195689743 GTCCCAGGGTCTGGGGAGAGGGG - Intronic
944158232 2:196631986-196632008 TTACCAGAGACTGTGGAGAAGGG + Intergenic
944381397 2:199114901-199114923 TTGCCTGGGGCTGGGGAGACTGG + Intergenic
944652190 2:201842150-201842172 TTACCAGGGACTGAGGAGAGGGG - Intronic
944904220 2:204246256-204246278 ACACCAGAGGCTGGGGAGGCGGG - Intergenic
945078087 2:206060413-206060435 ATCCCAGCTACTGGGGAGGCTGG + Intronic
945286699 2:208089482-208089504 ATCCCAGCTACTGGGGAGGCTGG + Intergenic
945393648 2:209295725-209295747 ATACAATGGACTGGGGACTCAGG + Intergenic
945638362 2:212388489-212388511 ATACCTGGAACTGGGCAGAGAGG + Intronic
945895001 2:215471737-215471759 ATCCCAGTGACTTGGGAGGCTGG + Intergenic
945912326 2:215663461-215663483 ATCCCAGCTACTTGGGAGACTGG + Intergenic
945934109 2:215885878-215885900 ATCCCAGGGACTGTGAATACTGG - Intergenic
946198933 2:218059429-218059451 TTACCAGGGACTGAGGGGAGGGG - Intronic
946209604 2:218136918-218136940 TTACCAGGGACTGAGGGGAGGGG + Exonic
946254651 2:218433787-218433809 ATCCCAGCTACTGGGGAGGCTGG + Intronic
946390436 2:219412335-219412357 ATCCCAGCTACTTGGGAGACTGG - Intergenic
947106611 2:226674445-226674467 CAACAAGGGACTGGGGAGAGAGG + Intergenic
947381541 2:229550108-229550130 ATCCCAGGTACTTGGGAGGCTGG - Intronic
947447706 2:230177148-230177170 AGACCACGGACTGGGCAGCCTGG + Intronic
947700957 2:232233498-232233520 TTGGCAGGGAGTGGGGAGACTGG + Intronic
947709137 2:232300768-232300790 GTACCAGGTACTCGGGAAACAGG - Intronic
948369075 2:237475778-237475800 TTGCCAGGGACTGGGGACATAGG - Intergenic
948677478 2:239607068-239607090 CTACCAGGGACTGGGGGGAGGGG + Intergenic
949024007 2:241756637-241756659 ATCCCAGAGACTCGGGAGGCTGG - Intronic
1169005594 20:2204670-2204692 TTACCAGGCACTGGGAACACAGG - Intergenic
1169151794 20:3295295-3295317 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1169969963 20:11259388-11259410 ATCCCAGCTACTGGGGACACTGG - Intergenic
1170118139 20:12883404-12883426 ATTCCAGGGACTGTGGAAATGGG + Intergenic
1170363162 20:15569548-15569570 TTACCAGGGACTTGGGTGGCTGG - Intronic
1170606286 20:17877244-17877266 TTGCCAGGGACTGGGAAGAGGGG + Intergenic
1171966675 20:31536010-31536032 ATACAAGGGCTTGGGGGGACAGG - Intronic
1172068299 20:32237232-32237254 ATGCTAGGTACTGGGGATACAGG + Exonic
1172620865 20:36317706-36317728 AAACCAGCAACTGGGGAGGCTGG - Intronic
1172665969 20:36600349-36600371 TTTCCAGGGACTGGGGAAATGGG + Intronic
1172689472 20:36780288-36780310 TTACCAGGGACTGGGGACAGGGG + Exonic
1172695619 20:36820722-36820744 ATCCCAGCTACTAGGGAGACTGG + Intronic
1172793315 20:37520932-37520954 AGGCCAGGGACTGGGGAGAAGGG + Intronic
1173266287 20:41485676-41485698 TTACCAGGGACTGGGGGGTGGGG + Intronic
1173442117 20:43087068-43087090 TTGCCAGGGACTGGGGAAATGGG - Intronic
1173580406 20:44142950-44142972 GCACCTGGGACTGGGGAGCCGGG + Intronic
1173730010 20:45321595-45321617 ATCCCAGCTACTTGGGAGACTGG + Intergenic
1173803725 20:45911064-45911086 ATCTCAGGGTCTCGGGAGACTGG - Intronic
1173825341 20:46044531-46044553 ATTCCAGGCAATGGGGAGCCAGG + Intronic
1173829233 20:46069228-46069250 TTACCAGTGGCTGGGGAGAGGGG - Intronic
1174073351 20:47914305-47914327 ATCCCAGCTACTTGGGAGACAGG + Intergenic
1174188085 20:48721199-48721221 ATTCCAGGCACTGAGGAAACAGG + Intronic
1174213127 20:48895711-48895733 ATCCCAGCTACTGGGGAGGCTGG - Intergenic
1174372739 20:50103913-50103935 ATACCAGATTCTGGGGAGGCGGG - Intronic
1174381389 20:50157648-50157670 TTACCAGGGGCTGGGGAAAGAGG - Intergenic
1174672621 20:52322190-52322212 GTGCCAGGGACTGGGGAGGCAGG + Intergenic
1174810499 20:53641218-53641240 ATCCCAGTTACTCGGGAGACAGG + Intergenic
1175723527 20:61301707-61301729 ATTTCAGGCAGTGGGGAGACAGG + Intronic
1175790023 20:61735230-61735252 ATTCCAGCTGCTGGGGAGACGGG - Intronic
1175943297 20:62547621-62547643 AGCCCAGGGAATGTGGAGACAGG - Intergenic
1176079252 20:63263558-63263580 ATCCCAGCTACTCGGGAGACAGG + Intronic
1176265631 20:64207898-64207920 CCTCCAGGGACTGGGGACACAGG - Exonic
1177740200 21:25145185-25145207 ATCCCAGCTACTGGGGAGGCAGG + Intergenic
1178460174 21:32795778-32795800 ATGCCAGGGATCGGGTAGACAGG + Intronic
1178906276 21:36639624-36639646 ATCCCAGGAAGTGGGGAGCCAGG + Intergenic
1179355792 21:40657832-40657854 ATACCAGGGAATGGAGAGTAAGG + Intronic
1179472664 21:41621908-41621930 ACACCAGGAACTCGGGAGAGAGG + Intergenic
1179495892 21:41771122-41771144 ACTCCAGGCACTGGGTAGACAGG - Intergenic
1179653901 21:42833280-42833302 TTACCTGTTACTGGGGAGACTGG + Intergenic
1180487609 22:15816975-15816997 AAAGCAGGGACTGGGGAGGAGGG - Intergenic
1180711339 22:17841678-17841700 CTAAAAGGGACTGGGGAGAATGG + Intronic
1180989570 22:19926862-19926884 TTGCCAGGGGCTGGGGAGAGGGG + Intronic
1181336756 22:22140853-22140875 ATACTAGGTGCTGGGGATACAGG + Intergenic
1181673819 22:24439198-24439220 ATCCCAGCTACTTGGGAGACAGG - Intronic
1181975405 22:26725532-26725554 TTACCAGGGACTGGGGGGGGCGG - Intergenic
1182558014 22:31139585-31139607 ATCCGAGGGACTGGGCAGGCTGG - Intronic
1182919857 22:34069343-34069365 ATCCCAGCTACTCGGGAGACTGG - Intergenic
1182937775 22:34242233-34242255 TTTCCAGGGGCTGGGGGGACAGG - Intergenic
1183013132 22:34963601-34963623 ATACCAGGGTCTGGAGTGAGGGG + Intergenic
1183336862 22:37253777-37253799 ATCCCAGCAACTCGGGAGACTGG - Intergenic
1183666110 22:39246776-39246798 GCTCCAGGCACTGGGGAGACAGG + Intergenic
1184241098 22:43211632-43211654 ATCCCAGCTACTCGGGAGACTGG - Intronic
1184539400 22:45110190-45110212 ATACCAAGGACTGTGGTTACTGG + Intergenic
1184551599 22:45207438-45207460 ATCCCAGGTACTTGGGAGGCTGG - Intronic
1184922895 22:47618266-47618288 ACAACAGGGTCTAGGGAGACAGG - Intergenic
949540046 3:5025840-5025862 ATACCAGCTACTGGAGAGGCTGG + Intergenic
950153393 3:10705768-10705790 ATACCAGTGTCTGGGGAGAAAGG - Intronic
950570669 3:13798076-13798098 ATCCCAGCTACTCGGGAGACAGG + Intergenic
952274380 3:31863242-31863264 TTGCCAGGGGCTGGGAAGACAGG + Intronic
952409767 3:33037161-33037183 ATTCCAGCTACTCGGGAGACTGG - Intronic
952554386 3:34515434-34515456 GTATCAGGGACTGTGGAGAGTGG - Intergenic
952810835 3:37401170-37401192 GTCCCAGCCACTGGGGAGACAGG - Intronic
952865778 3:37854294-37854316 AGCCCAGGGCCTGGGGAGCCTGG + Intergenic
953017901 3:39096025-39096047 ATAGCAGGGACTAGGGAGGGAGG + Exonic
953295218 3:41708505-41708527 TTACCAGGGACTGGGGGTAGGGG + Intronic
954236628 3:49262040-49262062 ATCCCAGCTACTTGGGAGACTGG + Intergenic
954354334 3:50072290-50072312 ATCCCAGCTACTCGGGAGACTGG + Intronic
955055719 3:55454330-55454352 TTACCAGGGGCTGGTGAGAGAGG - Intergenic
955307790 3:57851588-57851610 ATTCCAGCTACTCGGGAGACTGG - Intronic
956665843 3:71641364-71641386 ATCCCAGGTACTTGGGAGGCTGG - Intergenic
957902284 3:86510198-86510220 ATACCAGGGGCTGAGGAGAGGGG + Intergenic
958694807 3:97513656-97513678 TTACTAGAGACTGGGGAGAGTGG + Intronic
958901924 3:99897239-99897261 ATCCCAGCTACTTGGGAGACTGG + Intronic
960561792 3:119092445-119092467 ATCCCAGCTACTTGGGAGACAGG - Intronic
960925213 3:122788776-122788798 TTACCAGGGACTGGGGGAAGAGG + Intronic
961620700 3:128222149-128222171 ATCCCAGCTACTGGGGAGGCTGG - Intronic
961825429 3:129596725-129596747 AGACCAGGGGCTGGGGAGGAGGG - Intronic
962259082 3:133891819-133891841 ATACCAGGGGCAGGGCAGGCAGG + Intronic
962674083 3:137740311-137740333 TTACCAGGGACTGGGGGGAATGG - Intergenic
962743292 3:138378880-138378902 TTGCCAGGGACTGAGGAGAGGGG - Intronic
963007966 3:140743825-140743847 TTGCCAGGGGCTGGGGAGAAGGG + Intergenic
966003995 3:174985832-174985854 ATCCCAGCGACTTGGGAGGCTGG + Intronic
966117208 3:176479576-176479598 ATACAAGGGACTTTGGGGACTGG - Intergenic
966376855 3:179305121-179305143 ATCCCAGCTACTCGGGAGACAGG - Intergenic
966467959 3:180253160-180253182 ATGACAGGGATTGGGGTGACAGG + Intergenic
966777649 3:183556920-183556942 AATCCAGGGGGTGGGGAGACTGG + Intergenic
966976424 3:185087642-185087664 TTGCCAGGGACTGGGCATACGGG + Intronic
969636182 4:8370569-8370591 AGACCTGGGACCGGGGAGGCCGG + Intronic
969695954 4:8735002-8735024 ATACTAGGCCCTGGGGAGAATGG - Intergenic
969739198 4:9011987-9012009 TTAGCAGGGGCTGGGGGGACTGG - Intergenic
969783039 4:9425852-9425874 TTTCCAGGGACTGGGGAGGGAGG + Intergenic
970097317 4:12478731-12478753 CTATCAGGGAGTGGGGGGACTGG + Intergenic
970152115 4:13101072-13101094 ATACCAAGGAGTGGGGAGGTGGG - Intergenic
970196325 4:13553860-13553882 TTGCCAGGGTCTGGGGAGAGGGG - Intergenic
970581473 4:17477655-17477677 AAGCCAGGGACAGGGGAGCCTGG + Intronic
970986640 4:22166695-22166717 ATCCCAGCTACTCGGGAGACTGG - Intergenic
973868563 4:55140199-55140221 ATACCAGGGGCAGGGGTTACTGG + Intergenic
973978815 4:56289101-56289123 TTACCAGGGACTGCGGAGAGGGG + Intronic
973993196 4:56432408-56432430 ATCCCAGCTACTCGGGAGACAGG + Intronic
975544859 4:75550072-75550094 ATTCCAGGGGCTTGGGATACAGG - Intronic
976495961 4:85730002-85730024 ATGCCATGGCCTGGGGAGACAGG - Intronic
976653083 4:87456726-87456748 ATACCAAAAACTGGAGAGACAGG - Intronic
976693659 4:87895285-87895307 ATACCAGGGCCTGTGGGGGCTGG + Intergenic
976709695 4:88055822-88055844 TTACCAGGGACTGGGGGAATTGG - Intronic
977083277 4:92560822-92560844 ATCCCAGCCACTTGGGAGACTGG - Intronic
977990765 4:103438694-103438716 TTACTAGGGTCTGGGGAGGCAGG - Intergenic
978059284 4:104316557-104316579 ATACCCGGTACTGGGATGACTGG - Intergenic
978101606 4:104848367-104848389 ATCCCAGCTACTCGGGAGACTGG - Intergenic
978181172 4:105797884-105797906 ATTCCAGTTACTTGGGAGACAGG - Intronic
978533833 4:109740171-109740193 ATCCCAGCTACTCGGGAGACTGG + Intergenic
978740005 4:112125943-112125965 TTGCCAGGGACTGGGGAAAAGGG + Intergenic
978766159 4:112407135-112407157 TTGCCAGGAACTGGGGAGAGTGG + Intronic
979319611 4:119307965-119307987 TTACCAGGGGCTGGGGACAGAGG + Intergenic
979566333 4:122157943-122157965 AAAACAGGGACTTGGGAGACAGG - Intronic
979658278 4:123222697-123222719 TTACCAGGTGCTGGGGAGAGGGG - Intronic
980035296 4:127876751-127876773 ATACCAGCTACTTGGGAGGCTGG + Intergenic
980139118 4:128894793-128894815 ATCCCAGCTACTGGGGAGGCTGG - Intronic
980258011 4:130406873-130406895 TTACCAGAGACTGGGGATATAGG - Intergenic
980383013 4:132050235-132050257 ATCCCAGGTACTCGGGAGGCTGG - Intergenic
980588649 4:134854313-134854335 ATACCTGGGAGTGGGCTGACTGG - Intergenic
981081800 4:140644308-140644330 ACAGCAGGGAGTGGGGAGGCAGG + Intronic
981812960 4:148796141-148796163 ATGCCAGGCACTGAGGATACAGG - Intergenic
982095941 4:151923435-151923457 TTACCAGGGACTGGGGTAAGAGG + Intergenic
982111091 4:152055490-152055512 TTACCAGGGGCTGGGGAGGTGGG - Intergenic
982240990 4:153299151-153299173 ATACCAGAGGCTGGGGAGGGTGG - Intronic
982423230 4:155222976-155222998 ATACCAGCGACTCCGGAGGCAGG + Intergenic
982696552 4:158608799-158608821 TTGCCAGGGGCTGGGGAGAGGGG - Intronic
982909953 4:161127688-161127710 ATCCCAGCCACTCGGGAGACAGG - Intergenic
983228974 4:165111209-165111231 ATCCCAGATACTGGGGAGGCAGG - Intronic
983235986 4:165179601-165179623 TTGCCAGGGACTGGGGAGAGTGG - Intronic
984041993 4:174746479-174746501 ATACCAGGGACTGGGGAGACCGG + Intronic
984785028 4:183559969-183559991 TGACCAGGGACTGGGGAGTTAGG - Intergenic
984930927 4:184846510-184846532 ATTCTAGGGGATGGGGAGACAGG + Intergenic
985675948 5:1231383-1231405 ATGCCAGGAAGTGGGGGGACTGG + Intronic
985771014 5:1810810-1810832 TTACCAGGGGCTGGGGGGCCGGG - Intronic
986349015 5:6859682-6859704 AAACCAGGGACTGTGGAGGACGG - Intergenic
986514430 5:8546375-8546397 CTATCAAGGACTGGGGAGAGGGG + Intergenic
986744643 5:10732957-10732979 TTACCAGGGACTGGGGGAAAGGG - Intronic
986904842 5:12484269-12484291 ATGCCAGGATCTGGGGAGAGGGG + Intergenic
987212892 5:15702118-15702140 ATCCCAGCTACTTGGGAGACTGG + Intronic
987518857 5:18952590-18952612 ATAACAGAGACTGGGGAAAGTGG + Intergenic
988286256 5:29220361-29220383 ATACCAGAGACTGGGAAGGGTGG + Intergenic
988602774 5:32655069-32655091 CTGCCAGGGCCTGGGGAGAGAGG + Intergenic
989705528 5:44325718-44325740 ACACCAGGGCCTGGGGAGGGGGG + Intronic
990438591 5:55821289-55821311 ATCCCAGGGACTGGTGGAACAGG - Intergenic
990801057 5:59603733-59603755 TTACCAGGGGCTGGGGCAACTGG + Intronic
991162259 5:63517606-63517628 ATCCCAGCTACTGGGGAGGCTGG - Intergenic
992000592 5:72432425-72432447 ACACCAGGAAATGGGGAGATGGG + Intergenic
992062800 5:73072716-73072738 TTGCCAGGGGCTGGGGAAACTGG + Intronic
992936763 5:81715150-81715172 ACAGGAGGGGCTGGGGAGACAGG + Intronic
992989208 5:82266785-82266807 ATACCAAGTACTGGTGAGAAAGG - Intronic
994029890 5:95129776-95129798 ATCCCAGCTACTCGGGAGACTGG - Intronic
994083036 5:95729680-95729702 TTACCAGGGGCTGGGGAGAGGGG - Intronic
995411962 5:111867992-111868014 ACACCAGGGACTAGGGATAGGGG - Intronic
995898849 5:117046229-117046251 CTGCCAGGGCCTGTGGAGACAGG - Intergenic
996479131 5:123953624-123953646 ATCCCAGGTACTTGGGAGGCTGG - Intergenic
996814575 5:127560539-127560561 ATACCAGGGGCTGGGGGAGCGGG + Intergenic
997128253 5:131250552-131250574 TTGCCAGGGACTGTGGAGCCAGG + Intronic
997171052 5:131721321-131721343 TTACCAGGGGCTGGGGTGAGGGG + Intronic
998820198 5:146051115-146051137 ATCCCAGCTACTGGGGAGGCTGG + Intronic
998918191 5:147039183-147039205 CTACCAGGAATTGGGCAGACAGG - Intronic
999115141 5:149156148-149156170 ATACCTGGGACTGTGAAAACTGG + Intronic
999257500 5:150217733-150217755 AGCCCAGGGACGGGGGAGGCTGG + Intronic
999455221 5:151709720-151709742 ACACCAGAGACTGGGAAGAGTGG + Intergenic
1000218084 5:159183811-159183833 TTGCCAGGGGCTGGGGAGAAGGG + Intronic
1000753887 5:165132504-165132526 ATACCAGCTACTCGGGAGGCTGG + Intergenic
1001103998 5:168837581-168837603 ATAACAGGGACTCTAGAGACTGG + Intronic
1001408301 5:171492379-171492401 TTACCAGGGGCTGGAGAGAGGGG + Intergenic
1001877239 5:175212371-175212393 GTACCACGCACTGGGGAGCCGGG + Intergenic
1002165670 5:177343771-177343793 TTACCAGGGACTGTGGGGATGGG + Intronic
1002904262 6:1436170-1436192 TTGCCAGGGGCTGGGGAGAGGGG + Intergenic
1002962933 6:1933514-1933536 ATAACAAGTACTGGGGAGAATGG - Intronic
1003135207 6:3429881-3429903 TTACCAGGGGCTGGGGTGAGTGG + Intronic
1003482851 6:6548932-6548954 ATTCCAGCTACTTGGGAGACTGG + Intergenic
1003546492 6:7063787-7063809 TTACCAGGGACTGGGGGAAGGGG - Intergenic
1003589505 6:7425429-7425451 ATCTCAGCTACTGGGGAGACTGG - Intergenic
1003613982 6:7638345-7638367 TTACCAGAGGCTGGGGAGAGGGG + Intergenic
1005530858 6:26704313-26704335 AAAACAGGAACTGGGGAGAAAGG - Intergenic
1005539938 6:26797333-26797355 AAAACAGGAACTGGGGAGAAAGG + Intergenic
1005681748 6:28215741-28215763 TTACCAGGGGCTGGGAGGACAGG - Intergenic
1005736376 6:28751543-28751565 ATCCCAGCTACTCGGGAGACAGG + Intergenic
1006254345 6:32818130-32818152 TTACCAGAGGCTGGGGAGTCAGG + Intronic
1006318113 6:33302761-33302783 ATCCCAGCTACTCGGGAGACTGG - Intronic
1006376526 6:33674416-33674438 ATCTCTGGGACTGGGGAGGCAGG - Intronic
1006448040 6:34090886-34090908 AGACCAGGGGCAGGGCAGACGGG + Intronic
1006527049 6:34615476-34615498 ATCCCAGCTACTGGGGAGGCTGG + Intronic
1006542469 6:34751668-34751690 ATCCCAGCTACTCGGGAGACTGG - Intergenic
1006837498 6:37007806-37007828 AAACCAGGGACTGGGGTGCCAGG + Intronic
1007289374 6:40773654-40773676 ATAGCAGCAGCTGGGGAGACAGG - Intergenic
1007419145 6:41708836-41708858 AGACCAGTCACTGGGGAGACTGG + Intronic
1007551210 6:42731366-42731388 ATCCCAGCTACTCGGGAGACTGG - Intergenic
1007603909 6:43102469-43102491 ATACCAGCTACTTGGGAGACTGG + Intronic
1007622159 6:43221837-43221859 CTACCAGGTCCTGGGCAGACAGG + Intronic
1007797224 6:44359402-44359424 TTACCAGGGGCTGGGGAGAGGGG - Intronic
1007815116 6:44516783-44516805 ATACCAGAGACTGGAAAGAGTGG - Intergenic
1008616221 6:53229071-53229093 TTGCCAGGTACTGGGGAGAGGGG + Intergenic
1008951231 6:57161810-57161832 ATACCAGCTACTGTGGAGGCTGG - Intronic
1009010758 6:57839465-57839487 GTAACAGGAACTGGGGAGAAAGG + Intergenic
1009816662 6:68745421-68745443 TTACCAGGGAATGGGGAAATAGG + Intronic
1010306453 6:74328796-74328818 ATACCAGAGACTGGGAAGGGTGG - Intergenic
1010494264 6:76514108-76514130 ATACCTGAGACTGGGAAGAAAGG + Intergenic
1011126874 6:84017120-84017142 ATAACAGGGAATGGAGAAACAGG + Intergenic
1012405916 6:98897833-98897855 ATACCAGTGACTTGGGAGACTGG - Intronic
1012578811 6:100837713-100837735 TTACCAGAGGCTGGGGAGATTGG + Intronic
1012846166 6:104392302-104392324 ATTACAGAGACTGGGGAGAGGGG + Intergenic
1013254339 6:108369724-108369746 ATCCCAGCTACTTGGGAGACTGG - Intronic
1013446798 6:110237251-110237273 AGACCTGGTACTGGGGAGAAAGG - Intronic
1013803494 6:113971597-113971619 CTACCAGGCACTGGGGCGATGGG - Intronic
1014164292 6:118205966-118205988 TTACCAGGGACTGGGGAAGGGGG + Intronic
1014693158 6:124587015-124587037 TTTCCAGGGACTGGGGTGAGAGG + Intronic
1014747478 6:125216884-125216906 ATACCAGGGACTCAAGAGAAGGG + Intronic
1015117356 6:129664244-129664266 ATAGCAGGGGATGGGGAGATAGG + Intronic
1015739367 6:136437116-136437138 ATACCAGGGAGTGCTGAGAAGGG - Intronic
1016026730 6:139294869-139294891 ATCCCAGCTACTGGGGAGGCTGG + Intergenic
1016367110 6:143331360-143331382 TTACCAGGGACTCGGGGGAGTGG - Intronic
1016866716 6:148774898-148774920 ATCCCAGCTACTGGGGAGGCTGG + Intronic
1016884783 6:148949171-148949193 ATCCCAGCTACTGGGGAGGCTGG + Intronic
1016941115 6:149483489-149483511 GTGCCAGGGACTGGGGAAATGGG - Intronic
1017121029 6:151024072-151024094 CTCTCAGAGACTGGGGAGACTGG - Intronic
1017663296 6:156694836-156694858 TTACCAGGGACTAGGGAGATGGG + Intergenic
1017687325 6:156926645-156926667 ATAAAAGGGACAGGGGATACGGG - Intronic
1018314786 6:162546219-162546241 ATGCCAGGTACTTGGGAGACTGG - Intronic
1018467263 6:164060036-164060058 ATGCCAGTGACAGGGGAAACTGG - Intergenic
1019482032 7:1271297-1271319 ACCCCAGGAACTGGGGAGGCCGG + Intergenic
1019488006 7:1298295-1298317 AAACCAGGGGCTGTGGGGACAGG + Intergenic
1019755538 7:2766126-2766148 TTACCAGGGGCTGGGCAGATGGG - Intronic
1019929046 7:4211358-4211380 AGACCAGGGAGTGAGGAGGCCGG + Intronic
1020064837 7:5179881-5179903 ACCCCAGGGAGTGGGGAGAGAGG - Intergenic
1020273322 7:6609935-6609957 ATCCCAGGTACTCGGGAGGCTGG + Intergenic
1020826360 7:13034311-13034333 AAACCAATGTCTGGGGAGACTGG + Intergenic
1021763764 7:23926715-23926737 TTACAAGGGACTGGAGAGAGAGG - Intergenic
1022160390 7:27704616-27704638 TTGCCAGGGGCTGGGGAGAAGGG - Intergenic
1022681154 7:32547580-32547602 GAACCAGGGAGTGGGGAGACAGG - Intronic
1023049348 7:36237501-36237523 TTACCAGGGACTGGGGGAAAAGG - Intronic
1023173092 7:37408742-37408764 TTGCCAGGGGCTGGGGAGAAGGG + Intronic
1023189396 7:37563435-37563457 ATCCAAGGCACAGGGGAGACTGG + Intergenic
1023443790 7:40211090-40211112 ATACCAGCTACTCGAGAGACAGG - Intronic
1023672195 7:42589111-42589133 CTACCAGGGACTGGGGAGGTGGG - Intergenic
1024261160 7:47574840-47574862 TTGCCAGGGACTGGGGGGAGGGG + Intronic
1025020809 7:55477686-55477708 CTACCAGGAACTGGTGGGACGGG + Intronic
1025116305 7:56261466-56261488 TTTCCAGGGACAGGGGAGACAGG + Intergenic
1026200761 7:68212678-68212700 TTTCCAGGGACAGGGGAGACAGG + Intergenic
1027141084 7:75658203-75658225 ATCCCAGCTACTGGGGAGGCAGG - Intronic
1027389978 7:77695229-77695251 ATCCCAGCTACTGGGGAGGCTGG - Intergenic
1028129095 7:87149147-87149169 TTACCAGGGGCTGGGGAGAGGGG + Intergenic
1028815890 7:95144155-95144177 TTATCAGGGACTGGGGGGAGTGG - Intronic
1029116612 7:98241021-98241043 ATACCCTGTACTGGGGAGAAGGG - Intronic
1029324390 7:99793551-99793573 ATGCCAGGGTCTGGGGAGAGGGG - Intergenic
1029570126 7:101363420-101363442 ATGCCAGGGGCAGGGGACACGGG + Intronic
1029674779 7:102061040-102061062 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1030444022 7:109626106-109626128 ATCCCAGCTACTAGGGAGACTGG + Intergenic
1030622388 7:111804416-111804438 GTACCAGGGGCTGGGGAGACAGG + Intronic
1030877705 7:114835823-114835845 TTGCCAGGGACTGGGAGGACAGG - Intergenic
1031361817 7:120857352-120857374 ATGCAAGGGACTGGGGCGGCGGG + Intronic
1031678982 7:124647188-124647210 AGACCAAGGACTGTGGAGTCAGG + Intergenic
1031754207 7:125617960-125617982 ATATTAGGGACTGGGGTGTCAGG + Intergenic
1031759683 7:125697069-125697091 ATATCAGTGATAGGGGAGACAGG + Intergenic
1032869077 7:135961603-135961625 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1033151729 7:138920406-138920428 GTGCTAGGCACTGGGGAGACAGG - Intronic
1033215802 7:139492719-139492741 AGTCCAGGGCCTGGGCAGACTGG - Intergenic
1033288882 7:140064430-140064452 ATCCCAGCTACTCGGGAGACAGG + Intergenic
1033877938 7:145845180-145845202 ATCCCAGCTACTGGGGAGGCTGG + Intergenic
1033881897 7:145894729-145894751 TTACCAGGGGCTGAGGAGAGGGG - Intergenic
1033921562 7:146399330-146399352 ATACCAGAGACTGGAGGGAAGGG - Intronic
1034043045 7:147899388-147899410 TCACCAGGGGCTGGGAAGACGGG + Intronic
1034458397 7:151184573-151184595 TTGCCAGGGGCTTGGGAGACAGG + Intronic
1034647213 7:152658592-152658614 TTACCAGGAGCTGGGGAGGCGGG - Intronic
1034748176 7:153542729-153542751 TTACCAGGACCTGGGGAGAAGGG + Intergenic
1035380561 7:158437865-158437887 TTACCAGGCCCTGAGGAGACTGG - Intronic
1035447034 7:158950179-158950201 ATCCCAGGTACTTGGGAGGCTGG - Intronic
1035972178 8:4261394-4261416 TTGCCAGGGGCTGGGGAGAGGGG + Intronic
1036705930 8:11046978-11047000 GTGCCAGGGGCTGGGGAGAAGGG + Intronic
1036751772 8:11448074-11448096 ATCCCAGCTACTTGGGAGACTGG + Intronic
1036836021 8:12068206-12068228 TTTCCAGGGACTGGGGAGGGAGG - Intronic
1036857864 8:12314776-12314798 TTTCCAGGGACTGGGGAGGGAGG - Intergenic
1036932837 8:12972992-12973014 CTCCCAGGGCCTGGGGAGTCAGG - Intronic
1037108754 8:15141231-15141253 ATACCAGGGACTGGTGGTAGGGG + Intronic
1037257230 8:16969155-16969177 TTACCAGGGGCTAGGGAGAGAGG + Intergenic
1037793690 8:21972359-21972381 GTCCCAGCGACTTGGGAGACAGG + Intronic
1037998557 8:23370729-23370751 CCTCCAGGGACTGGGGAGACCGG + Intronic
1038771315 8:30483770-30483792 TTACCAGGGGCTGGGGAAAAGGG - Intronic
1038900678 8:31840229-31840251 ATACTATGGACTAGGTAGACTGG - Intronic
1038927467 8:32156596-32156618 ATATGAGGGAATGGGGATACAGG - Intronic
1039529557 8:38248460-38248482 ATACCAAGTACTGGATAGACTGG + Intronic
1039635991 8:39166213-39166235 ATACAATGGACTGTGGGGACTGG - Intronic
1039643967 8:39259315-39259337 ATACCAGCTTCTGGGGAGGCTGG - Intronic
1039870830 8:41543821-41543843 ATACCAGCTACTCGGGAGGCTGG - Exonic
1040511969 8:48104195-48104217 GTCCCAGCTACTGGGGAGACAGG - Intergenic
1040519440 8:48162577-48162599 ATATCAGCTACTCGGGAGACTGG - Intergenic
1040868583 8:52076807-52076829 ATACCAGGGGAGGGGGAGAGGGG - Intergenic
1041079713 8:54204597-54204619 TTGCCAGGGACTGGGGATAGGGG - Intergenic
1041739664 8:61144845-61144867 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1042213521 8:66405244-66405266 ATGCCAGGCACTGGGGATATAGG - Intergenic
1042931935 8:74022694-74022716 ATCCCAGCTACTGGGGAGGCTGG - Intronic
1044289665 8:90452988-90453010 ACAAGAGGGACTGGAGAGACAGG - Intergenic
1044996702 8:97844208-97844230 ATCCCAGCTACTTGGGAGACTGG - Intronic
1045385870 8:101670476-101670498 AGACCAGGGACTGGGAAGTGAGG + Intergenic
1045394951 8:101751320-101751342 TTACCAGGGACTGGGATGTCGGG + Intronic
1045910120 8:107397631-107397653 TAAGTAGGGACTGGGGAGACCGG + Intronic
1046239373 8:111470960-111470982 AAACCAGGGACAGGGAAGACTGG + Intergenic
1046637623 8:116689259-116689281 ATACCAGAGACTGGGAAGGAAGG + Intronic
1046649324 8:116819434-116819456 TTACCAGGGGCTGGAGAGAGAGG + Intronic
1046906243 8:119576253-119576275 ATCCCAGCTACTAGGGAGACTGG - Intronic
1047182292 8:122600622-122600644 TTGCCAGGGAATGGGGAGAGAGG + Intergenic
1047435006 8:124829050-124829072 GTCCCAGGGTCGGGGGAGACTGG + Intergenic
1047517450 8:125567544-125567566 TTGCCAGGGACTGGGAAGAGAGG + Intergenic
1047522312 8:125604450-125604472 GTGCCAGGCACTGGGGAGGCAGG - Intergenic
1047914905 8:129572530-129572552 ATTCCAGCTACTGGGGAGGCTGG + Intergenic
1048128940 8:131670387-131670409 ATACCAGAGACTGGGAAGGTTGG - Intergenic
1048559953 8:135524131-135524153 ATCCCAGCTACTCGGGAGACTGG - Intronic
1049445829 8:142631042-142631064 ACACCAGGGAGTGGGGAGCTGGG + Intergenic
1049497841 8:142945046-142945068 ATCAAAGGGGCTGGGGAGACTGG - Intergenic
1049638289 8:143701237-143701259 ATCCCAGGTACTTGGGAGGCTGG - Intronic
1049707624 8:144050211-144050233 AGATCAGGAACTGCGGAGACGGG + Intergenic
1049772014 8:144387517-144387539 ATCCCAGCTACTGGGGAGACTGG - Intronic
1049810521 8:144566735-144566757 ATCCCAGATACTTGGGAGACTGG + Intronic
1049842533 8:144782370-144782392 ATCCCAGTAACTTGGGAGACTGG + Intronic
1049853240 8:144845657-144845679 ATGACAAGGACTGTGGAGACAGG - Intronic
1050242568 9:3652553-3652575 ATACCAGAGACTGGGAAGAGTGG - Intergenic
1050306712 9:4312348-4312370 ATCCCAGCTACTGGGGAGGCTGG + Intronic
1050543364 9:6688960-6688982 CTACCAGAGGCTGGGGAGAGTGG - Intergenic
1050547487 9:6721189-6721211 ATCCCAGCTACTGGGAAGACTGG - Intronic
1050874181 9:10613848-10613870 GTACCACAGACTCGGGAGACAGG + Intergenic
1050886021 9:10766156-10766178 ATCCCAGCTACTGGGGAGGCTGG + Intergenic
1050935460 9:11389333-11389355 TTACCAGGGACTGGAGAAGCAGG + Intergenic
1051030788 9:12674989-12675011 ATACCAGAGACTGGGAAGGGTGG - Intergenic
1051074508 9:13215127-13215149 CTCCCAGGGACTGGGGAGAGGGG - Intronic
1051224632 9:14885996-14886018 TTACCAGGGGCTGGGGAGGAGGG - Intronic
1051718897 9:20014713-20014735 TTACCAGAGGCTGGGGAGAGAGG + Intergenic
1051760057 9:20452845-20452867 TTACCATGGGCTGGGGAGAGAGG + Intronic
1052386841 9:27832774-27832796 ATACCTGGCGCTGGGGAAACTGG - Intergenic
1052745806 9:32440147-32440169 ATCCCAGCTACTTGGGAGACTGG + Intronic
1053085173 9:35213319-35213341 ATACCAGATGCAGGGGAGACCGG - Intronic
1053148393 9:35727543-35727565 AGAGCTGGAACTGGGGAGACTGG - Intronic
1053803131 9:41776609-41776631 ATCCTAGGTACTGGGGAGGCTGG - Intergenic
1054142132 9:61538513-61538535 ATCCCAGGTACTGGGGAGGCTGG + Intergenic
1054191423 9:61987919-61987941 ATCCTAGGTACTGGGGAGGCTGG - Intergenic
1054461886 9:65469693-65469715 ATCCCAGCTACTGGGGAGGCTGG + Intergenic
1054646946 9:67599793-67599815 ATCCTAGGTACTGGGGAGGCTGG + Intergenic
1054797822 9:69318874-69318896 ATTCCAGGGACTGTTGAGAAAGG + Intergenic
1054986382 9:71266773-71266795 TTACCAGGGACTGAGGAGAGGGG - Intronic
1055003100 9:71475838-71475860 ATACCAGGGACTCTGGAAAATGG + Intergenic
1055331645 9:75190115-75190137 ATCCCAGATACTCGGGAGACTGG + Intergenic
1055447484 9:76397162-76397184 ATCCCAGCTACTCGGGAGACTGG + Intergenic
1055493119 9:76826355-76826377 ATCCCAGCTACTTGGGAGACAGG + Intronic
1055738038 9:79354006-79354028 ATCCCAGCTACTTGGGAGACAGG + Intergenic
1055747229 9:79462338-79462360 TTGCCAGGGAATGAGGAGACAGG + Intergenic
1056510460 9:87299634-87299656 TTACCAGAGACTGGGGAGAGAGG - Intergenic
1056747892 9:89320236-89320258 ATCCCAGGTATTCGGGAGACTGG + Intronic
1057350213 9:94290408-94290430 TTACCAGGGGCTGGGGGGAGTGG - Intronic
1057446316 9:95117837-95117859 ATCCCAGATACTTGGGAGACAGG - Intronic
1057590284 9:96367100-96367122 ATCCCAGGTACTCGGGAGGCTGG + Intronic
1057743282 9:97731398-97731420 TTACCAGGGCCTGGGGAGTGAGG - Intergenic
1057760462 9:97869673-97869695 ATCCCAGCTACTTGGGAGACTGG - Intergenic
1057896660 9:98914622-98914644 ATACCAGAGACTGGGAAGGGTGG - Intergenic
1058014004 9:100009473-100009495 ATGCCAGGGGGTGGGGAGAGGGG - Intronic
1058017300 9:100048848-100048870 TTGCCAGGGGCTGGGGAGAATGG + Intronic
1058223829 9:102336421-102336443 TTACCAGGGGCTGTGGAGAAGGG - Intergenic
1058778513 9:108309786-108309808 ATGCCAGGACCTAGGGAGACAGG - Intergenic
1058888864 9:109343839-109343861 ATCCCAGGTACTTGGGAGGCTGG - Intergenic
1059101774 9:111479041-111479063 ATACTAGAGACTGAGGACACTGG + Intronic
1059377771 9:113899303-113899325 CTACCAGGGACTGGGGGAAGGGG - Intronic
1060443575 9:123666040-123666062 TTGCCAGGGGTTGGGGAGACAGG + Intronic
1060562929 9:124561792-124561814 ATACCAGCTACTCGGGAGGCTGG + Intronic
1060628035 9:125131047-125131069 ATACCTGGGACTGGGACTACAGG + Intronic
1060756965 9:126220562-126220584 AAGCCAGGGACAGGGGAGCCAGG + Intergenic
1060799950 9:126537427-126537449 ATTCCAGGTACTGGGGCTACAGG + Intergenic
1060937084 9:127522063-127522085 AGGCCAGGGGCTGGGGAGGCGGG + Intronic
1061161153 9:128895011-128895033 ATACCAGGGCCTGGGGGAGCAGG - Intronic
1061166895 9:128928147-128928169 ATCCCAGGGAATGGGAAGAATGG + Intronic
1061397430 9:130351038-130351060 TTGCCAGGGGCTGGGGAGAAGGG - Intronic
1062082857 9:134633644-134633666 TTTCCAGGGAGAGGGGAGACGGG - Intergenic
1062153788 9:135034694-135034716 GTGCCAGGGGCTGGGGAGAGGGG - Intergenic
1062582725 9:137235612-137235634 ACACTGGGGACTGAGGAGACGGG + Intronic
1062584766 9:137244279-137244301 TAAACAGGAACTGGGGAGACAGG + Exonic
1185595797 X:1305962-1305984 ATCCCAGTGACTCGGGAGGCTGG + Intronic
1185857348 X:3548142-3548164 ATCCCAGCTACTGGGGAGATTGG + Intergenic
1186030907 X:5368017-5368039 ATGCCAGGGAGTGTGGAGAGGGG + Intergenic
1186213547 X:7275123-7275145 TTACCAGGGACTGGGGTTAGGGG + Intronic
1186479293 X:9883864-9883886 ACCCCAGGGTCTGGGGAGAAGGG - Intronic
1186931075 X:14390921-14390943 TTGCCAGGAACTGGGGAGAGGGG + Intergenic
1187078188 X:15957513-15957535 TTACCAGGGGCTGGGGTGAGGGG - Intergenic
1187317983 X:18215287-18215309 TTACCAGGGACTGAGGTGAGGGG - Intronic
1187429271 X:19206761-19206783 ATACCAGGTGCTGGGGATAGTGG - Intergenic
1187503609 X:19860448-19860470 TTACCAGGGACTGGGGGGAGGGG + Intronic
1187640736 X:21286179-21286201 ATAACTGGGACTGGGGCCACTGG + Intergenic
1187693594 X:21896368-21896390 TTACCAGGGGCTGGGGGGAAGGG - Intergenic
1187699843 X:21954952-21954974 ATACCAGCTACTCGGGAGGCTGG - Intronic
1187746000 X:22410098-22410120 ATCCCAGCTACTTGGGAGACCGG - Intergenic
1187897426 X:23995863-23995885 ATCCCAGCTACTCGGGAGACAGG - Intronic
1188015453 X:25103436-25103458 ATCCCAGGGAAGGGGGACACTGG + Intergenic
1188039405 X:25354471-25354493 ATCCCAGCTACTCGGGAGACTGG + Intergenic
1188393528 X:29651601-29651623 ATACCAGAGGCTGGGGTGGCTGG + Intronic
1188813506 X:34682656-34682678 TTACCAGGGGCTGGGCAGAGGGG - Intergenic
1188898191 X:35695621-35695643 ATCCCAGCTACTGGGGAGGCAGG + Intergenic
1189482504 X:41403765-41403787 ATCCCAGCTACTGGGGAGGCTGG - Intergenic
1189985400 X:46549027-46549049 TTACCAAGGACTGGGGATGCAGG - Intergenic
1190073409 X:47297621-47297643 GTCCCAGCTACTGGGGAGACTGG + Intergenic
1190891948 X:54577063-54577085 TTACCAGGGACTGGAGGGAAAGG - Intergenic
1191953686 X:66621727-66621749 ATATCAGGGCCTGGGGAGAAAGG + Intronic
1192179126 X:68904907-68904929 TTACCAGGGACTGGGGGGAGGGG - Intergenic
1192348766 X:70336909-70336931 TTGCCAGGGACTGAGGAGAGAGG - Intronic
1192384033 X:70647233-70647255 TTACCAGGGACTAAGGAGTCGGG + Intronic
1192586312 X:72320941-72320963 TTACCAGGGCCTGGGCAGAGGGG - Intergenic
1192629411 X:72764476-72764498 ATCCCAGAGACTGGGGAGATTGG + Intergenic
1192652299 X:72956338-72956360 ATCCCAGAGACTGGGGAGATTGG - Intergenic
1192743867 X:73919402-73919424 ATTCAAGGGTCTGGGGAGAAGGG + Intergenic
1192786189 X:74338216-74338238 ATCCCAGCTACTTGGGAGACTGG - Intergenic
1192845298 X:74900983-74901005 CTGCCAGGGGCTGGGGAGAAGGG + Intronic
1193120783 X:77820972-77820994 TTGCCAGGGGCTGGGGAGAAGGG - Intergenic
1193320893 X:80119907-80119929 ATCCCAGCTACTTGGGAGACAGG + Intergenic
1193369010 X:80670529-80670551 GTCCCAGGTACTTGGGAGACAGG - Intergenic
1194652664 X:96534028-96534050 TTACCAGGGACTGGGGCGGAGGG + Intergenic
1195769609 X:108336463-108336485 TTGCCAGGGGCTGGGGAGAGAGG + Intronic
1196409682 X:115402402-115402424 ATACCAGGCAGTGGGTAGAAGGG - Intergenic
1196548343 X:116992165-116992187 TTACCAGGGACTGGGGTGAGTGG - Intergenic
1196642992 X:118085362-118085384 TTGCCAGGAACTGGGGAGAGGGG + Intronic
1196668249 X:118338683-118338705 ATACCAGGGGCTGGGAATCCTGG + Intergenic
1196985283 X:121263248-121263270 TTACCAGGGACTGGGGATTGTGG - Intergenic
1197160879 X:123320536-123320558 ACTCAAGGTACTGGGGAGACAGG + Intronic
1197770975 X:130089106-130089128 CTACCAGGGCCTGGCCAGACAGG + Intronic
1198754439 X:139968324-139968346 TTACCAGGGGCTGGGTAGAGTGG + Intergenic
1199225811 X:145371969-145371991 ATTCCAGCGACTTGGGAGGCTGG - Intergenic
1199268494 X:145855729-145855751 GTGCCAGGGGCTGGGGGGACGGG + Intergenic
1199754091 X:150848374-150848396 CTGCCAGGGGCTGGGGAGAGTGG + Intronic
1200119563 X:153783961-153783983 AAGCCAGAGTCTGGGGAGACGGG - Exonic
1200194717 X:154239949-154239971 TTACCAGGGACTGGGGTGATGGG - Intergenic
1201161514 Y:11170599-11170621 ATCCCAGCTACTTGGGAGACAGG - Intergenic
1201712108 Y:17003940-17003962 TTGCCACGGACTGGGGAGAGAGG - Intergenic
1202041618 Y:20691234-20691256 ATAACTGGTACTGGGGAAACTGG - Intergenic
1202065559 Y:20935955-20935977 GTACCAGTTACTGGGGATACAGG - Intergenic
1202171532 Y:22050667-22050689 ATACTAGCTACTGGGGAGGCTGG - Intergenic
1202219830 Y:22535705-22535727 ATACTAGCTACTGGGGAGGCTGG + Intergenic
1202323347 Y:23660378-23660400 ATACTAGCTACTGGGGAGGCTGG - Intergenic
1202547424 Y:26009676-26009698 ATACTAGCTACTGGGGAGGCTGG + Intergenic