ID: 984043249

View in Genome Browser
Species Human (GRCh38)
Location 4:174763922-174763944
Sequence CTCATTATGACTCATATATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984043249 Original CRISPR CTCATTATGACTCATATATG AGG Intronic
904013071 1:27401113-27401135 CACATTATGATTTATACATGTGG + Intergenic
906722061 1:48015257-48015279 ATCTTTATGACTTAGATATGAGG - Intergenic
906905496 1:49886331-49886353 CTCATTTTCACACATATTTGAGG - Intronic
915873219 1:159584434-159584456 CTGATTATCACTCTGATATGTGG - Intergenic
918504728 1:185240385-185240407 ATTATTTTGACTCATATTTGGGG + Intronic
1063075008 10:2706797-2706819 CCCTTCATGACTCATCTATGAGG - Intergenic
1064331015 10:14394149-14394171 CTCAATAAGATTAATATATGTGG - Intronic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1067260672 10:44687633-44687655 CTCATTATCTCTAATATTTGAGG + Intergenic
1067511720 10:46900992-46901014 CTCATTTTGAGCCATATATCAGG + Intergenic
1067650526 10:48150833-48150855 CTCATTTTGAGTCATATATCAGG - Intergenic
1068343458 10:55739416-55739438 CTCATTGTGACTAAAATATTAGG - Intergenic
1071308560 10:84322190-84322212 CTCTGTGTGCCTCATATATGTGG - Intergenic
1072486311 10:95859260-95859282 CTCACTGTGACTCAGAGATGAGG - Intronic
1078814351 11:14804062-14804084 TTCTTTATGACTCAAATATGGGG + Intronic
1080842369 11:35996754-35996776 CTCATTATGATTTATATTTGTGG - Intronic
1082234527 11:49807533-49807555 CATGTTCTGACTCATATATGTGG - Intergenic
1083507807 11:63175919-63175941 TTCCTTATGGCACATATATGTGG + Intronic
1085362501 11:75903167-75903189 CTCATTATGTCTAATATGTATGG + Intronic
1085476445 11:76792125-76792147 ATCAGCATGACTCAGATATGCGG + Exonic
1087969221 11:104458696-104458718 GTCTTTTTGACTCATATATGTGG - Intergenic
1089040981 11:115449515-115449537 CTGATTATGACTCTTCTAGGGGG - Intronic
1091006239 11:131956270-131956292 CACATTCTGACTCACATGTGGGG - Intronic
1092839073 12:12521331-12521353 CTCTTTATGAATCAAATGTGAGG - Exonic
1093491726 12:19712416-19712438 CTGATGAAGACTCATGTATGAGG + Intronic
1094252647 12:28382532-28382554 CTCATTTTATCTCATATATGAGG - Intronic
1095587042 12:43860970-43860992 CCCATTATGGCTCCTTTATGGGG + Intronic
1099233429 12:80053808-80053830 CTTATTTTGAATAATATATGGGG + Intergenic
1099556535 12:84115205-84115227 CTCATTTTGACTCATTTTTTAGG - Intergenic
1101448273 12:104753953-104753975 GTTATTATGACCCAAATATGGGG - Intronic
1102945665 12:116985759-116985781 CTCATTCTCACTTATATATTAGG - Intronic
1104388258 12:128369869-128369891 CTAATTTAGGCTCATATATGAGG - Intronic
1108638244 13:52357609-52357631 CTTATTATACCTCATATAAGTGG - Intergenic
1110433388 13:75452735-75452757 CTCCGTATCACTCATATATCAGG - Intronic
1110943903 13:81389111-81389133 CTGCTTATGACCCATAAATGAGG + Intergenic
1111928606 13:94490006-94490028 CTAATTATGACAAATATAGGTGG + Intergenic
1112815908 13:103272871-103272893 CTCATGATACCTCCTATATGAGG + Intergenic
1112866849 13:103913031-103913053 TACAATATGACACATATATGAGG - Intergenic
1117324570 14:54657242-54657264 CTCATTATGTCACAGATAGGTGG - Intronic
1118422308 14:65620329-65620351 CTCATTATCAGTAATATATAGGG + Intronic
1119237258 14:73030141-73030163 ATAATAATGACCCATATATGAGG + Intergenic
1126321958 15:47434741-47434763 CTCCTTCTGAATCATATGTGAGG + Intronic
1126945979 15:53820600-53820622 ATCATGATGACTGATATATGGGG - Intergenic
1127813691 15:62587574-62587596 CTCAACATGTCTCATATCTGTGG + Intronic
1133667199 16:7980087-7980109 CTCATTATTATTTATATATTTGG - Intergenic
1133988524 16:10687000-10687022 CTCATGATCACACATGTATGTGG + Intronic
1138616956 16:58176249-58176271 CTCATTAGGACTTTTATCTGTGG + Intronic
1145764156 17:27446723-27446745 TTTATTTTGACTCATATTTGTGG + Intergenic
1150596128 17:66606839-66606861 CAAATTATGACTCATTTATGTGG + Intronic
1154264465 18:12868052-12868074 CTCCTTAAGTCTCAAATATGTGG + Intronic
1154410424 18:14138106-14138128 CTATTTCTGACTCATATTTGTGG - Intergenic
1156848073 18:41692530-41692552 CTTATTGTGACTTATCTATGTGG + Intergenic
1156985310 18:43344062-43344084 CTGATTTTGACTCATAAAAGGGG + Intergenic
1157191943 18:45589091-45589113 CTCATTATGGCACATATTTATGG + Intronic
1159298881 18:66536088-66536110 CTCAGCATGTCTCATCTATGTGG + Intronic
1160281701 18:77496947-77496969 CTCATTATTGGTCATTTATGAGG - Intergenic
1166641355 19:44497722-44497744 CTCAATATGCCTGATATTTGTGG - Intronic
1168479337 19:56705717-56705739 CATATTCTGACTCATATGTGGGG + Intergenic
928366149 2:30705123-30705145 TTCATTATGACACATTTCTGAGG + Intergenic
929994026 2:46813952-46813974 TTCATTAAGACTCATATTGGTGG - Intergenic
931490720 2:62743642-62743664 CTGATTATGACACATGTGTGAGG - Intronic
931844531 2:66189501-66189523 ATCATCATGCCTCATCTATGAGG + Intergenic
931958929 2:67459895-67459917 AGCATTCTGACTCAGATATGAGG - Intergenic
935391409 2:102557101-102557123 CTCAGTAGGCCTCATATTTGGGG + Intergenic
943473448 2:188324720-188324742 CTCATTATGTTTCAAATTTGAGG + Intronic
944498263 2:200330450-200330472 TTCATTGTGATTCAAATATGAGG - Intronic
945178078 2:207063748-207063770 TTTATTATGACTCTTAAATGAGG + Intergenic
1168957176 20:1842386-1842408 CTCAAGATGAATCATATAAGTGG - Intergenic
1169567701 20:6873502-6873524 ATTATTTTGACTCATAGATGGGG - Intergenic
1175449234 20:59048265-59048287 CTCATTATGACACATCACTGTGG + Intergenic
1176862641 21:14020306-14020328 CTATTTCTGACTCATATTTGTGG + Intergenic
1178778045 21:35571338-35571360 CTCCTTCTCACTCATATCTGTGG - Intronic
1179099691 21:38345894-38345916 CTCATGATGACTCAAATGTCAGG - Intergenic
1181170666 22:21007606-21007628 CTCATTGAGACTTATAAATGTGG + Intergenic
1181730293 22:24841234-24841256 CTGTTTATGACTCTTATTTGTGG + Intronic
951029584 3:17866641-17866663 CTCATCTTGACTAATACATGAGG - Intronic
951574747 3:24102108-24102130 CTCATTATAACTGAAATATGTGG + Intergenic
952532376 3:34275691-34275713 CTGATTAGGAATCATATCTGAGG - Intergenic
953794019 3:45969303-45969325 CTCATTCTAGCTCATAAATGAGG - Intronic
954990121 3:54833440-54833462 CTGCTTATGATTCATACATGTGG - Intronic
956380277 3:68657666-68657688 TTCATTATGATTCATATTTAAGG - Intergenic
958167378 3:89894056-89894078 CTCATTATGTCTCCCAGATGAGG - Intergenic
958566060 3:95811809-95811831 CACTGTATAACTCATATATGAGG - Intergenic
961927545 3:130497172-130497194 CACATTATTTCTCTTATATGCGG - Intergenic
964144667 3:153444880-153444902 CTAATAAAGTCTCATATATGGGG + Intergenic
967939952 3:194757856-194757878 CTAATGATGCCTGATATATGGGG + Intergenic
971068311 4:23060294-23060316 CTCATTATGAATATTATATAAGG + Intergenic
972877937 4:43388305-43388327 CTCATTATGAATCATGTTGGTGG - Intergenic
978004081 4:103595474-103595496 TTCATTCTCACTAATATATGAGG - Intronic
978448437 4:108803187-108803209 ATCATTAAGACTCAAATAAGTGG + Intergenic
979220816 4:118221658-118221680 CTCATAAAGACTAATGTATGTGG + Intronic
979294691 4:119018172-119018194 CTCATTCTCACTCACATGTGAGG - Intronic
979753096 4:124303674-124303696 CTCATTGTGGCTGATTTATGAGG - Intergenic
981157623 4:141458487-141458509 CTCATTTTATTTCATATATGAGG + Intergenic
981942758 4:150302719-150302741 CTCGTTCTGAGTCATATATTGGG - Exonic
982583621 4:157209593-157209615 CTCATTCTGACACATTTATTAGG + Intronic
982894272 4:160897300-160897322 CTTATTAGGACTTAGATATGTGG + Intergenic
984043249 4:174763922-174763944 CTCATTATGACTCATATATGAGG + Intronic
986984761 5:13488106-13488128 CTCATTATCTCACTTATATGTGG - Intergenic
987918374 5:24246676-24246698 TTCATAATGACTTATCTATGCGG + Intergenic
988107747 5:26772469-26772491 TTCATTGTGATTCATCTATGGGG - Intergenic
988237927 5:28570975-28570997 TTCAGTATTACACATATATGTGG + Intergenic
989446028 5:41529472-41529494 CACATTATGTCTCTTATATGTGG - Intergenic
989446096 5:41530617-41530639 CACATTATGTCACTTATATGTGG + Intergenic
989552613 5:42753523-42753545 CACATTAAGATTCATATAGGAGG - Intergenic
990802345 5:59619198-59619220 CTCATTCAGACTGAAATATGGGG + Intronic
993135305 5:83953519-83953541 ATTATTTTCACTCATATATGAGG + Intronic
994957838 5:106557492-106557514 CTCATTATGGTTCAGATATTGGG - Intergenic
995874376 5:116775174-116775196 CTCATTATTAAGCACATATGGGG - Intergenic
996010445 5:118476593-118476615 CCCATTATGACTGTTTTATGGGG + Intergenic
996651096 5:125877353-125877375 ATCATTCTGACTGATATATGAGG + Intergenic
997688813 5:135811333-135811355 CTCATGATCTCACATATATGTGG + Intergenic
1007142023 6:39585617-39585639 ATGATTATGATTTATATATGTGG - Intronic
1010126720 6:72440951-72440973 CTCAGCATGGCTCATATTTGTGG + Intergenic
1012744054 6:103060534-103060556 CTTATTATGACTGATATGTCTGG - Intergenic
1013910271 6:115267654-115267676 CTCATTTTGAATTAGATATGTGG - Intergenic
1016447112 6:144145664-144145686 CACATGATGACACTTATATGTGG + Intergenic
1020726716 7:11824332-11824354 CTCATTCTAACTCATATCAGAGG + Intronic
1020961739 7:14813370-14813392 CTCATTGGTACTCATTTATGTGG - Intronic
1026684737 7:72499467-72499489 CTCATTATGATACATAAATAAGG + Intergenic
1027853137 7:83474246-83474268 CCCATTATTACTCATGTATCAGG - Intronic
1030914025 7:115290065-115290087 CAAATTATCAATCATATATGAGG - Intergenic
1037331156 8:17745058-17745080 CTTATTCTGACCCAAATATGAGG - Intronic
1040862470 8:52013793-52013815 CTCATTATCAGTCACATATAAGG + Intergenic
1042000190 8:64113637-64113659 ACAATTATAACTCATATATGTGG - Intergenic
1045180657 8:99777867-99777889 TACATTTTGACTCATATATTAGG + Intronic
1047539422 8:125750099-125750121 CTCATTATGATTCCACTATGAGG - Intergenic
1050085138 9:1957656-1957678 GTCATCATGAATCAAATATGTGG - Intergenic
1050691012 9:8225831-8225853 CTCATTATGATATATATGTGGGG + Intergenic
1051752660 9:20359451-20359473 CTCATTATCTCTTATAGATGGGG - Intronic
1051859492 9:21608089-21608111 CTCATTATAAGCCATCTATGTGG - Intergenic
1051985945 9:23087118-23087140 CAGATGATCACTCATATATGTGG - Intergenic
1052619849 9:30892368-30892390 ATCATAATGACTCTTATATAGGG - Intergenic
1056930243 9:90869371-90869393 CTAATGATGACACATATATAAGG + Intronic
1187819512 X:23271770-23271792 CTCATTAAGAATCATGTATTTGG - Intergenic
1189325348 X:40108126-40108148 CCCATTATGACTCATAAAATCGG + Intronic
1193489237 X:82127897-82127919 CTCCAGATGACTCATATAGGTGG - Intergenic
1194137757 X:90168240-90168262 TGCATTATGTCTCATATATCAGG + Intergenic
1198217827 X:134572775-134572797 ATAATTTTGAATCATATATGTGG - Intronic
1200483546 Y:3738510-3738532 TGCATTATGTCTCATATATCAGG + Intergenic
1200843777 Y:7810763-7810785 ATGATAATGACTAATATATGTGG - Intergenic
1200857021 Y:7949948-7949970 ATCATAATGACTCTTATATGTGG - Intergenic
1200858939 Y:7969435-7969457 ATGATAATGACTCTTATATGTGG - Intergenic
1202264358 Y:23002381-23002403 ATAATAATGACTCTTATATGTGG + Intronic
1202270751 Y:23071835-23071857 ATCATAATGACTCTGATATGCGG + Intergenic
1202295275 Y:23348847-23348869 ATCATAATGACTCTGATATGCGG - Intergenic
1202417349 Y:24636123-24636145 ATAATAATGACTCTTATATGTGG + Intronic
1202423746 Y:24705579-24705601 ATCATAATGACTCTGATATGCGG + Intergenic
1202447043 Y:24964506-24964528 ATCATAATGACTCTGATATGCGG - Intergenic
1202453437 Y:25033963-25033985 ATAATAATGACTCTTATATGTGG - Intronic