ID: 984045572

View in Genome Browser
Species Human (GRCh38)
Location 4:174793527-174793549
Sequence GCCCAGAAGTTCAACGTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 1, 2: 13, 3: 140, 4: 479}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984045572_984045578 12 Left 984045572 4:174793527-174793549 CCCGCAACGTTGAACTTCTGGGC 0: 1
1: 1
2: 13
3: 140
4: 479
Right 984045578 4:174793562-174793584 CCTGTGTCAGCCGCCTAATGGGG No data
984045572_984045576 11 Left 984045572 4:174793527-174793549 CCCGCAACGTTGAACTTCTGGGC 0: 1
1: 1
2: 13
3: 140
4: 479
Right 984045576 4:174793561-174793583 TCCTGTGTCAGCCGCCTAATGGG 0: 1
1: 0
2: 1
3: 18
4: 489
984045572_984045575 10 Left 984045572 4:174793527-174793549 CCCGCAACGTTGAACTTCTGGGC 0: 1
1: 1
2: 13
3: 140
4: 479
Right 984045575 4:174793560-174793582 CTCCTGTGTCAGCCGCCTAATGG 0: 1
1: 0
2: 2
3: 49
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984045572 Original CRISPR GCCCAGAAGTTCAACGTTGC GGG (reversed) Intronic
900724669 1:4208175-4208197 GCCCAGGAGTTCAAAGCTGAAGG - Intergenic
901574053 1:10185659-10185681 GCCCAGAAATTCAAGGCTGCTGG + Intergenic
901708650 1:11096551-11096573 GCCCAGGAGTTCAAGGCTACAGG - Intronic
901874394 1:12158693-12158715 GCCCAGCAGTTCTACTTTCCAGG + Intergenic
901983637 1:13055977-13055999 ACCCAGGAGTTAAAGGTTGCAGG + Intronic
901998451 1:13172947-13172969 ACCCAGGAGTTAAAGGTTGCAGG - Intergenic
904452206 1:30621056-30621078 GCTCAGAAGTTCTGGGTTGCAGG + Intergenic
904549438 1:31303203-31303225 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
904583442 1:31564807-31564829 GCCCAGAAGATCAAGAGTGCTGG + Intergenic
904738724 1:32655064-32655086 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
905194926 1:36268577-36268599 GCCCAGAAGTTCAAGGCTGCAGG - Intronic
905238152 1:36564704-36564726 ACCCAGGAGTTCAAAGCTGCAGG - Intergenic
905349875 1:37338096-37338118 GACCAGCAGTTCAATGTAGCTGG + Intergenic
905579937 1:39076647-39076669 GCCCAGTAGCTCAAGGTTACTGG + Intergenic
906017817 1:42598089-42598111 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
906617722 1:47245991-47246013 GCTGAGAAGTTCAAAGTTGAGGG + Intergenic
906905683 1:49889260-49889282 GCCCAGGAGTTCAAGGATTCAGG + Intronic
907117002 1:51977723-51977745 GCCCAGGAGTTCGACGCTGCAGG + Intronic
908311400 1:62888190-62888212 GCCCAGCAGTTTGACGTTGCAGG - Intergenic
908377039 1:63553909-63553931 ACCCAGGAGTTCAAGGTTACAGG - Intronic
910482067 1:87669742-87669764 CCCCAGATGTTCAGCTTTGCAGG + Intergenic
910579972 1:88812657-88812679 GCCTAGGAGTTCAAGGTTACAGG + Intronic
910864496 1:91775798-91775820 GCCCAGAAATTCAGCACTGCAGG - Intronic
911135894 1:94439943-94439965 GGCCAGGAGTTCAAGGCTGCAGG - Intronic
911381159 1:97116593-97116615 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
911607339 1:99922957-99922979 GCCCAGAAGTTTTAGTTTGCTGG - Exonic
912496181 1:110093590-110093612 GCCCAGAAGCTTAAGGCTGCAGG + Intergenic
912884739 1:113458585-113458607 GCCCAAGAGTTCAAGGCTGCAGG - Intronic
913681988 1:121194764-121194786 GCCCAGGAGTTCGAGATTGCAGG + Intronic
914033825 1:143982388-143982410 GCCCAGGAGTTCGAGATTGCAGG + Intergenic
914155622 1:145085584-145085606 GCCCAGGAGTTCGAGATTGCAGG - Intronic
914421488 1:147532306-147532328 GCCCAGGAGTTCCAGGTTACAGG - Intergenic
915396020 1:155584815-155584837 GCCCAGGTGTTCAAGGCTGCAGG - Intergenic
915453659 1:156024564-156024586 GCCCAGGAGTTCGAGGCTGCAGG + Intergenic
915653330 1:157335910-157335932 TTCCAGAAGTTCAGCCTTGCTGG + Intergenic
915684242 1:157615597-157615619 TTCCAGAAGTTCAGCCTTGCTGG - Intergenic
916731264 1:167569011-167569033 GCCCAGAAGATCAAGGCTGCAGG + Intergenic
917354143 1:174108153-174108175 GCCCAGGAGTTGGAGGTTGCAGG + Intergenic
917526923 1:175796321-175796343 GCCCAAAATGTCAAGGTTGCTGG - Intergenic
917849958 1:179053357-179053379 GCCCAGGAGTTCCAGGCTGCAGG + Intronic
917935040 1:179858076-179858098 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
918221624 1:182440879-182440901 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
918491215 1:185083531-185083553 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
919125618 1:193389338-193389360 CCCCAGGAGGTCAACATTGCAGG - Intergenic
920079928 1:203365580-203365602 GCTCAGGAGTTCAACGTTGCAGG + Intergenic
920469304 1:206213273-206213295 GCCCAGGAGTTCGAGATTGCAGG + Intronic
922295939 1:224249808-224249830 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
922544812 1:226448247-226448269 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
922859625 1:228804966-228804988 ACCCAGAAGTTCAGAGTTCCAGG - Intergenic
923029358 1:230235135-230235157 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
924270577 1:242327996-242328018 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
924307062 1:242700507-242700529 GTCCAGGAGTTCAAGGTTACAGG + Intergenic
924584195 1:245347395-245347417 GCCCAGGAGTTCAAGGCTACAGG - Intronic
924587618 1:245373979-245374001 GCCCAGGAGTTCCAGGCTGCAGG + Intronic
924642587 1:245848483-245848505 GCCCAGGAGTTCGAGGCTGCAGG - Intronic
1062936572 10:1394994-1395016 GCCCAGGAGTTCGAGGCTGCAGG - Intronic
1063317280 10:5018687-5018709 ACCCAGGAGGTCAACGCTGCAGG - Intronic
1063541632 10:6939877-6939899 GCCCAAGAGTTCAAAGCTGCAGG + Intergenic
1063892590 10:10645575-10645597 GCCCAGAAGTTCAAGGCTGCAGG + Intergenic
1064052408 10:12069597-12069619 GCCCAGGAGTTCGAGGCTGCAGG - Intronic
1064100536 10:12460335-12460357 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
1065358041 10:24861848-24861870 GGCCAGAAGTTCAAGGTTACAGG - Intronic
1065452543 10:25874228-25874250 GCCTAGGAGTTTGACGTTGCTGG + Intergenic
1065477894 10:26160566-26160588 GCCCAGGAGTTCAAGGTTACAGG + Intronic
1065732236 10:28720218-28720240 GCCCAGGAGTTCGAGGCTGCAGG - Intergenic
1065815871 10:29482103-29482125 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
1065912339 10:30319553-30319575 GACCAGTAGTTCAACTTTGGTGG - Intronic
1065957057 10:30703133-30703155 GCCCAGGAGTTCGAGGCTGCAGG + Intergenic
1065961213 10:30735719-30735741 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
1066203806 10:33167276-33167298 GCCCAGGAGTTCCAGGCTGCAGG - Intergenic
1066291665 10:34020086-34020108 GCCCAGAATTTCAAAGCTGCAGG - Intergenic
1066341834 10:34541951-34541973 GCCCAGGACTTCAAGGCTGCAGG - Intronic
1066427965 10:35325997-35326019 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
1066714369 10:38270798-38270820 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1067129837 10:43553323-43553345 GCCCAGGAGATCAAGGCTGCAGG - Intergenic
1067339077 10:45386387-45386409 GTCCTGAAGTTCAAGGCTGCAGG + Intronic
1069266650 10:66466552-66466574 ACCCAGAAGGTCAGTGTTGCTGG - Intronic
1069329040 10:67268442-67268464 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
1069693583 10:70370941-70370963 GCCCAGGAATTCAAGGCTGCAGG + Intronic
1070065896 10:73034135-73034157 GCCCAGGAGTTCAAGGATGCAGG + Intronic
1070074454 10:73121633-73121655 GCCAAGGAGTTCAAGGCTGCAGG - Intronic
1070108780 10:73462233-73462255 GCCTAGGAGTTCAAGGCTGCAGG - Intronic
1070629895 10:78077029-78077051 GCCCAGGAGTTCAAGGCTGCAGG - Intergenic
1071166303 10:82811453-82811475 CCCCAGAATTTCACCATTGCAGG - Intronic
1072363562 10:94685108-94685130 GCCCAGGAGCTCAAGGCTGCAGG - Intronic
1072971221 10:100019457-100019479 GCCCAGGAGGTCAAGGTTGCAGG + Intergenic
1073379132 10:103064761-103064783 GCTCAGGAGTTCAAGGCTGCAGG + Intronic
1074388374 10:113035526-113035548 GCCCAGGAGTTTCACGCTGCAGG - Intronic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1075403409 10:122177490-122177512 GCCCAGGAGTTCAAGGCTACAGG + Intronic
1075888637 10:125925484-125925506 GCCCAGGAGTTCAAGGCAGCAGG - Intronic
1076001800 10:126918482-126918504 GCCCAGAATGTCAACAGTGCAGG - Intronic
1076241477 10:128911604-128911626 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1078162846 11:8856828-8856850 GACCAGGAGTTCAAGGCTGCAGG - Intronic
1078260052 11:9697855-9697877 GCATAGGAGTTCAAGGTTGCAGG - Intronic
1079072823 11:17362995-17363017 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1079158220 11:17968625-17968647 GCCTAGGAATTCAAGGTTGCAGG + Intronic
1079512189 11:21224317-21224339 GCCCAGGAGGTCAAGGTTGCAGG - Intronic
1080115860 11:28621117-28621139 GCCCAGAAGTTCAAGGCTACAGG - Intergenic
1080460450 11:32450341-32450363 GCCCAGAAAATCAACCTTGATGG - Intergenic
1080611701 11:33909858-33909880 GCCCAGGATTTCAAGGTTGCAGG + Intergenic
1080617661 11:33959039-33959061 GCCCAGGAGTTCAAGGCTGCAGG + Intergenic
1082721839 11:56687258-56687280 GCCCAGGAGTTCAAGGCTGCTGG + Intergenic
1084499563 11:69526681-69526703 GCCCAGAAGTTCGAGGCTGCAGG + Intergenic
1085108315 11:73865176-73865198 GCCCAGGAGTTCAAGACTGCAGG + Intergenic
1085135068 11:74079276-74079298 GCCCAGGAGTTCAAAGTTACAGG - Intronic
1085488731 11:76893291-76893313 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
1086088975 11:82985786-82985808 GCCCAGAAGTTGAAGGCTGCAGG - Intronic
1086185512 11:84010367-84010389 GCTCAGAAGTTCAAGGTTACAGG - Intronic
1086304354 11:85463692-85463714 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
1086929278 11:92674597-92674619 GCCCTGGAGTTCAAGGCTGCAGG - Intronic
1088609455 11:111563275-111563297 GCCGAGAAGTCCAAGGTTGAGGG - Intergenic
1089702051 11:120251042-120251064 GCATAGGAGTTCAAGGTTGCGGG - Intronic
1090010536 11:123041893-123041915 GCCCAGGAGTTCAACATAGTGGG - Intergenic
1090212821 11:124934949-124934971 GCCCAGCAGTTCATCACTGCTGG - Intronic
1092180940 12:6446376-6446398 GCCCAGGAGTTCAAGGCTGTGGG - Intronic
1092249260 12:6883440-6883462 GTCCAGGAGTTCAAGGCTGCAGG + Intronic
1092897347 12:13025500-13025522 GCCCAGGGGTTCAAGGTTACAGG - Intergenic
1093062201 12:14618722-14618744 GCCCAGGAGTTCAAGTTTACAGG + Intronic
1093247622 12:16759741-16759763 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1094557434 12:31515226-31515248 GCCCATAAGTTCAAGGCTGCAGG + Intronic
1094719695 12:33051793-33051815 GCTGAGAAGTTCAAGGTTGAGGG - Intergenic
1095041591 12:37447941-37447963 ACCCAGGAGTTCAAGGCTGCAGG + Intergenic
1095253901 12:40011206-40011228 GCCAAAAAGTTCTATGTTGCAGG + Intronic
1095772877 12:45981716-45981738 GCCCAGGAGGTTAAGGTTGCAGG + Intronic
1096107952 12:49009199-49009221 GCCCAGAAGGTCAAGGCTGCAGG - Intronic
1096205501 12:49718302-49718324 GACCAGAAGTTCAAGACTGCAGG + Intronic
1097792400 12:63828757-63828779 GTCCAGGAGTTCAAGGCTGCAGG + Intergenic
1097929043 12:65164317-65164339 GCCCAGGAGTTCAAGGTTGCAGG - Intergenic
1098188294 12:67921853-67921875 GCCCAGGAGCTCAAGGCTGCAGG - Intergenic
1098560952 12:71871668-71871690 GCCCAGGAGTTCAAGGTTGTAGG - Intronic
1098893741 12:76034149-76034171 GCCCAGAAGTTCAAGGTTGCAGG + Intergenic
1099069459 12:78027366-78027388 GCTCAGAAGTTCAAAGCTGCAGG + Intronic
1100176239 12:92034142-92034164 GCCCAGAAGTTCAAGGCTGCAGG - Intronic
1100192799 12:92210637-92210659 GCCCAGGAGTTCATGGGTGCAGG + Intergenic
1100499725 12:95162188-95162210 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
1100594341 12:96058965-96058987 GCCCAGGAGTTCAAGGCTACAGG - Intergenic
1101010922 12:100448115-100448137 GCCCTGAAGGTCAAGGCTGCAGG + Intergenic
1101405285 12:104423209-104423231 GCCCAGAAGTTCAACCAGCCTGG - Intergenic
1101764792 12:107687687-107687709 GCCCAGGAGTTCACAGCTGCAGG + Intronic
1102041959 12:109806782-109806804 GGCCAGAAGTTCAAGGCTGCAGG + Intronic
1102381428 12:112469996-112470018 GCCCAGAAGGTCAAGGCTGCAGG - Intronic
1102500865 12:113351510-113351532 GCCCAGGAGTTCGAGGCTGCAGG - Intronic
1103324721 12:120112799-120112821 ACCCAGGAGTTCAAAGTTACAGG - Intronic
1103765759 12:123278621-123278643 GCCCAAGAGTTCGAGGTTGCAGG - Intergenic
1103837599 12:123835699-123835721 GCCCATAAGTTCAAGGCTACAGG - Intronic
1104059699 12:125257227-125257249 GCCCAGGAGTTCAAGGCTGCTGG + Intronic
1104900190 12:132185698-132185720 GCCCAGGAGGTCAAGGGTGCAGG + Intergenic
1105307724 13:19180879-19180901 GCCCAGGGGTTCAAGGCTGCAGG + Intronic
1105642898 13:22284600-22284622 GCCTAGGAGTTCAATGTTGTGGG - Intergenic
1106847212 13:33749169-33749191 GCCCAGGAGATCATGGTTGCAGG - Intergenic
1107344218 13:39441587-39441609 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1107565097 13:41594197-41594219 GCCCAGGAGTTCAAAGTTCAAGG - Intronic
1107811200 13:44201247-44201269 GCCCAGAAGGCCAAAGTTGCAGG + Intergenic
1108392693 13:49962641-49962663 GCCCAGGAGATCAACCCTGCAGG + Intergenic
1108715321 13:53072868-53072890 GCCCAGGAATTCGAGGTTGCAGG - Intergenic
1110450441 13:75634359-75634381 GCCCAGGAGTTCAAGGTCACGGG + Intronic
1110509373 13:76330921-76330943 GCCCAGAAATTCATCATTCCTGG - Intergenic
1112014605 13:95321156-95321178 GCCCGGGAGTTCAAGGTTGCAGG + Intergenic
1112543652 13:100342796-100342818 GCCCAGGAATTCAAGGCTGCAGG - Intronic
1113419107 13:110155984-110156006 GGCCAGGAGTTCAAGGCTGCAGG + Intronic
1113835168 13:113324010-113324032 ACCCAGAAGTTAAAAGTTGAAGG + Intergenic
1115345145 14:32335025-32335047 GCCTAGAATTTCAAGGCTGCAGG - Intronic
1115366781 14:32566997-32567019 GCCCAGGAGTTCCAGGCTGCAGG - Intronic
1115756267 14:36528454-36528476 GCCCAGTAGTTCAAGGCTGCAGG - Intergenic
1116467290 14:45248980-45249002 GCCCAGGATTTCGAGGTTGCAGG - Intronic
1116628678 14:47300564-47300586 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1116750988 14:48883139-48883161 GCCCAGGAGTTCAAGGATGCAGG - Intergenic
1116887728 14:50237146-50237168 GCCTAGGAGTTCAAGGCTGCAGG - Intergenic
1116887909 14:50238427-50238449 GCCCAAGAGTTCAAGGCTGCAGG + Intronic
1116888020 14:50239509-50239531 GCCCAAGAGTTCAAGGCTGCAGG - Intronic
1116902892 14:50378608-50378630 GCCTAGGAGTTCAAGGCTGCAGG - Intronic
1116919327 14:50556290-50556312 GCCCAGGAGTTCAAGGATTCAGG - Intronic
1117150863 14:52886405-52886427 GCCCAGGAGTTCAACCTGGGTGG - Intronic
1117247828 14:53903288-53903310 GCCCAGGAGTTCAAGAATGCCGG + Intergenic
1117482176 14:56158416-56158438 GCCCAGGAGGTCAAGGTTGCAGG - Intronic
1119646444 14:76351906-76351928 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
1120034408 14:79680306-79680328 GCCCAGGAGGTGAAGGTTGCAGG + Intronic
1121010088 14:90514818-90514840 GCCCAGGAGTTCGAGGTTGCAGG + Intergenic
1121345384 14:93131902-93131924 GCCCAGGAGTTGAAAGCTGCAGG - Intergenic
1121349579 14:93162641-93162663 GCCCAGGAGTTTAAGGCTGCAGG + Intergenic
1122259889 14:100510342-100510364 GCCCAGAAGTTCCAGGCTGCAGG - Intronic
1123962738 15:25422919-25422941 GCCCAGGAGTTTGAGGTTGCAGG + Intronic
1124270768 15:28278304-28278326 GCCCAGGAGGTCAAAGCTGCAGG + Intronic
1125611809 15:40976501-40976523 GCACAGAGGTTCAAAGTTGGAGG - Intergenic
1126029503 15:44482221-44482243 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
1126055413 15:44725566-44725588 GCTGAGAAGTTCAACATTGAGGG - Intergenic
1126945442 15:53813859-53813881 GCCCAGGAGTTCAAGACTGCAGG - Intergenic
1127600228 15:60528130-60528152 GCCCAGGAGTTCAAGGCTCCTGG - Intronic
1127779354 15:62297888-62297910 GCCCAGGAGTTCAAGGCTGCAGG - Intergenic
1127941767 15:63705228-63705250 GCCCAGGAATTCGAAGTTGCAGG - Intronic
1128164534 15:65451846-65451868 GCCCAGGAGTTTGACGCTGCAGG + Intronic
1128466085 15:67913306-67913328 GCTCAGGAGTTCAAGGCTGCAGG + Intergenic
1128485286 15:68079907-68079929 GCCCAGGAGGTGAAGGTTGCAGG - Intronic
1129347146 15:74929685-74929707 GCCCAGGAGTTCAAGGTCGTAGG + Intronic
1129414435 15:75367559-75367581 GCCAGGAAGTTCACCTTTGCTGG - Exonic
1130406902 15:83610454-83610476 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1131173501 15:90195168-90195190 GCCCAGGAGGTCAAAGCTGCAGG - Intronic
1132025861 15:98403976-98403998 GCCCAGAAGTTCAAAGCTACTGG - Intergenic
1132038599 15:98506163-98506185 GCCCAGAAGATCTAAGTGGCAGG + Intronic
1132179833 15:99743883-99743905 GCCCAGGAGTTCCAGGCTGCAGG + Intergenic
1133152071 16:3841562-3841584 GCCCAGGAGTTCGAGGCTGCAGG + Intronic
1133747807 16:8700671-8700693 TCCCAGGAGTTCAAGGCTGCAGG - Intronic
1134078732 16:11310211-11310233 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1134665245 16:16013943-16013965 GCCCTGATGCTCAACGTTCCCGG - Intronic
1134686892 16:16165335-16165357 ACCCAGGAGTTCAAGGCTGCAGG + Intronic
1135106228 16:19652251-19652273 GCCCAGGAGTTCGAGGTTACAGG - Intronic
1135432445 16:22396979-22397001 GCCCAGGAGGTCAAAGCTGCAGG + Intronic
1135469178 16:22713814-22713836 GCCTAGGAGTTCAAGGCTGCAGG + Intergenic
1135522525 16:23188433-23188455 GCCCAGGAGTTCTAGGCTGCAGG + Intronic
1135532786 16:23268963-23268985 GCCCAGGAGTTCAAGGTTGCAGG - Intergenic
1135661684 16:24302529-24302551 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
1136171244 16:28490991-28491013 GCCCAGGAGTTCCAGGCTGCAGG + Intronic
1136250172 16:28999174-28999196 GCTCAGGAGTTCAAGGCTGCAGG - Intergenic
1136405931 16:30047035-30047057 GCCCAGGAGTTCAAGGCTACAGG - Intronic
1137266785 16:46875423-46875445 GCCCAGGAGTTCGAGGCTGCAGG + Intergenic
1137275934 16:46933464-46933486 GCCCAGGAGTTCAAGGCTGCAGG + Intergenic
1137350275 16:47707612-47707634 GCCCAGGAGTTCAAGGCTGCAGG + Intergenic
1137908098 16:52346427-52346449 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
1138075029 16:54033738-54033760 GCCCAAAAGTTCAAGGCTGCAGG + Intronic
1138359674 16:56417331-56417353 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1139515136 16:67448273-67448295 GCCCAGGAGATCAAGGCTGCAGG + Intronic
1139587432 16:67913106-67913128 GCCCAGGAGTTCAAGGTTGCAGG + Intronic
1139680725 16:68559943-68559965 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1139687525 16:68616046-68616068 GCGAAGAAGATCAACGATGCAGG - Intergenic
1140401730 16:74677426-74677448 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1140887605 16:79258712-79258734 TCACAGAAGTTCAAGTTTGCTGG - Intergenic
1141296766 16:82777020-82777042 ACTCAGAAGTTCAAGGCTGCAGG - Intronic
1141634259 16:85305359-85305381 GCCCAGGAGTTCGAGGCTGCAGG - Intergenic
1142527155 17:551488-551510 GCCCAGAGGGTCAAGGCTGCAGG + Intronic
1143704838 17:8689889-8689911 GCCCAGAAGTTCAAGGCTATAGG + Intergenic
1144695722 17:17302780-17302802 GCCCAGAAACTCAAGGCTGCAGG + Intergenic
1144855789 17:18266997-18267019 GCTCAGCAGTTCAGCCTTGCGGG - Intergenic
1145741216 17:27276264-27276286 GCTCAGGAGTTCAAGGCTGCAGG - Intergenic
1145966499 17:28922163-28922185 GCCCAGTAGTTCAAGACTGCAGG - Intronic
1146993622 17:37298032-37298054 GCCCAGCAGTTTGAGGTTGCAGG - Intronic
1147017350 17:37502945-37502967 GCTCAGGAGTTCAAGGTTGTAGG - Intronic
1147052241 17:37803964-37803986 GTGCAGAAGTTCAAGGCTGCAGG - Intergenic
1147397022 17:40151615-40151637 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1147406436 17:40215809-40215831 GCCCAGAAGTTCAAGACTACAGG + Intergenic
1147695606 17:42350356-42350378 GCCCAGGAGTTAGAGGTTGCAGG - Intronic
1147764209 17:42822777-42822799 GCCCAGGAGGTCAAAGCTGCAGG - Intronic
1148339504 17:46864895-46864917 GCCCAGAAGTTCTGCTCTGCTGG - Intronic
1148427843 17:47615478-47615500 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
1150459538 17:65337034-65337056 GCCCAGAGGGTCAAGGCTGCAGG - Intergenic
1151650440 17:75465074-75465096 GACCAGGAGTTCAAGGCTGCAGG - Intronic
1151779289 17:76232309-76232331 GCCCAGTAGGTCGACGCTGCAGG + Intronic
1152702594 17:81826444-81826466 GCCCAGGAGGTCAAGGCTGCAGG + Exonic
1153215228 18:2813860-2813882 GCCCAGGAGATCAATGCTGCAGG + Intergenic
1153498086 18:5720917-5720939 GCCCAGGAGTTCAAGGCTACAGG - Intergenic
1153538335 18:6127851-6127873 TCCCAGAAGTTCACCATTGATGG + Intronic
1153700127 18:7684221-7684243 GCCCAGGGGTTAAAGGTTGCAGG + Intronic
1155069942 18:22306218-22306240 GCCCAGGAATTCAAGGCTGCTGG + Intergenic
1155128631 18:22906214-22906236 GCCCAGAAGGTCAAGGCTGCAGG - Intronic
1155356143 18:24955887-24955909 GCCCAGGAGTTTGAGGTTGCAGG + Intergenic
1157126800 18:44963811-44963833 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
1157512452 18:48286972-48286994 GCCCAGAAGGCAAAGGTTGCAGG + Intronic
1157968323 18:52235647-52235669 GCCCAGAAGTTCAAGGCTGCAGG + Intergenic
1158006669 18:52680325-52680347 CCCCAGGAGTTCAACTTTCCAGG + Intronic
1159522009 18:69538457-69538479 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1161059080 19:2205768-2205790 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1161346023 19:3769176-3769198 GCCCAGAAGGTCGAGGCTGCAGG - Exonic
1161396830 19:4049050-4049072 GCCCAGGAGTTCGAGGCTGCAGG - Intronic
1161859533 19:6787671-6787693 GCCCAGAAGTTTGAGGCTGCAGG - Intronic
1161949170 19:7458208-7458230 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1162016363 19:7848690-7848712 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
1162361863 19:10225297-10225319 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
1162405565 19:10471126-10471148 ACCCAGAAGTTCAAGGCTGTAGG - Intergenic
1162473007 19:10883522-10883544 GCCCAGAAAGTCCACGGTGCCGG + Intronic
1162571456 19:11476466-11476488 GCCCAGAAGTTTGAGGATGCAGG + Intronic
1162645083 19:12043053-12043075 GCCCAAGAGTTCAAGGCTGCAGG + Intronic
1162676405 19:12301781-12301803 ACCCAGAAGGTCAAGGCTGCAGG + Intergenic
1162697244 19:12485747-12485769 GCCCAGAAGGTCGAGGCTGCAGG - Intronic
1162875755 19:13619751-13619773 GCCCAGGAGTTAGAGGTTGCAGG - Intronic
1162878085 19:13635941-13635963 GCCCAGAAGTTGAAGACTGCAGG + Intergenic
1162929495 19:13950242-13950264 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1162947517 19:14052800-14052822 GCCCAGGAGTTCGAAGCTGCAGG + Exonic
1162980829 19:14238524-14238546 GCCCAGGAGTTCAATACTGCAGG - Intergenic
1163042172 19:14610594-14610616 GCCCAGAAGTTTGAGGCTGCAGG - Intronic
1163766625 19:19166680-19166702 GCCCAGGAGTTCAAGGTCACAGG + Intronic
1165218312 19:34293604-34293626 GCCCAGAAGTTCAACCAGCCTGG - Intronic
1165284125 19:34825201-34825223 GCCCAGGAGTTCAAGGGTGCAGG + Intergenic
1165440934 19:35827050-35827072 GCCCAGAAGGTGGAGGTTGCAGG - Intronic
1166145967 19:40835405-40835427 GCCTAGGAGTTCAAGGCTGCAGG + Intronic
1166229613 19:41418606-41418628 GCCCAGAAGTTCAAGGCTGCAGG - Intronic
1166858481 19:45795495-45795517 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
1167152081 19:47716153-47716175 GCTCAGGAGTTCAAGGCTGCAGG - Intronic
1167328892 19:48841867-48841889 GCCCAGGAGTTCAAGGCTTCAGG + Intronic
1167456439 19:49598743-49598765 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
1167481565 19:49735120-49735142 GCCCTGGAGTTCAAGGCTGCAGG + Intergenic
1167859657 19:52272541-52272563 GCCCGGGAGTTCAAGGCTGCAGG - Intronic
1168579846 19:57545934-57545956 GCCCAGGAGTTCGAGGTTACAGG + Intronic
1168709395 19:58490020-58490042 GCCCAGGAGTTCTAGGTTGCAGG - Intronic
925241807 2:2337864-2337886 GCCCAAGAGTTCAAGGCTGCAGG + Intergenic
926054600 2:9767176-9767198 GCCCAGAAGGTCGAGGCTGCAGG - Intergenic
926257486 2:11219709-11219731 GCCCAGGAGTTCGAGGCTGCAGG - Intronic
926551929 2:14311428-14311450 GCCAAGAAGTCCAAGGTTGAGGG + Intergenic
926987939 2:18644491-18644513 CCCCAGGAGTTCAAAGCTGCAGG - Intergenic
927549132 2:23981809-23981831 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
927587501 2:24320636-24320658 GCCCAGGAGATCAAGGCTGCAGG + Intronic
927604460 2:24473809-24473831 GCCAAGATGTTCAAGGCTGCAGG + Intergenic
927674326 2:25093415-25093437 GCCCAGAAGGTCGAGGCTGCAGG + Intronic
927689498 2:25197779-25197801 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
928014699 2:27645042-27645064 GCCCAGTAGTTCGAGGCTGCAGG - Intronic
928110624 2:28505998-28506020 GCTCAGAAGTTCTACTTTCCTGG + Intronic
928201924 2:29252899-29252921 GCCCAGAAATTCGAGGCTGCAGG - Intronic
928500105 2:31882239-31882261 GCCCAGGAATTCCAGGTTGCAGG + Intronic
928989129 2:37212960-37212982 GCCCAGAAGGTCTAGGCTGCAGG + Intronic
929182933 2:39063197-39063219 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
929232510 2:39574048-39574070 GCCCAGTAGTTCAAGTCTGCAGG - Intergenic
929496821 2:42451821-42451843 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
929658931 2:43763494-43763516 GCCCAGGAGGTCAAGGATGCAGG - Intronic
929664850 2:43826050-43826072 GCCCAGTAGGTCAAGGCTGCAGG - Intronic
930012298 2:46946498-46946520 GCCCAAGAGTTCAACGCTGTAGG - Intronic
931472105 2:62548729-62548751 GCCCAGGAGTTCAAGGCTGCAGG - Intergenic
932762611 2:74448750-74448772 GGCCAGCAGCTCAAGGTTGCAGG + Intergenic
932790638 2:74651966-74651988 GCCCAGGAGTTCAAGGCTGCAGG - Intergenic
933232494 2:79825110-79825132 GCCCAGGAGTTCAAGGCTGCCGG + Intronic
933464510 2:82635455-82635477 GCCCAGGAGTTCGAGGCTGCAGG + Intergenic
933723974 2:85415926-85415948 GCTCAGGAGTTCAAGGCTGCAGG - Intronic
933744728 2:85562155-85562177 GCCCAGTAGTTCGAGGCTGCAGG + Intronic
933746568 2:85576097-85576119 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
933936695 2:87210484-87210506 GTCCAGTAGTTCAAGGTTACAGG - Intergenic
934721852 2:96584225-96584247 GCCCAGGAATTCAAGGCTGCAGG - Intergenic
934727443 2:96633067-96633089 GCCCACAAGTTCAACAGTGTGGG + Intronic
935379168 2:102433297-102433319 GCCCAGAAGTTCAAGACTGCAGG - Intronic
936356450 2:111755341-111755363 GTCCAGTAGTTCAAGGTTACTGG + Intergenic
936592258 2:113815443-113815465 GCCGAGGAGTTCGAGGTTGCCGG + Intergenic
938007950 2:127803869-127803891 GCCCAGGAGTTCCAGGCTGCAGG + Intronic
938846983 2:135220114-135220136 GCCCAGGAGTTCAAGGTGGTAGG - Intronic
939379203 2:141413148-141413170 GCCCGGGAGTTCAAGGCTGCAGG + Intronic
939385355 2:141489050-141489072 GCCCAGAAGGTGAAGGCTGCAGG - Intronic
940771263 2:157841626-157841648 GCCCAAAAGTTCAAGGTTGGAGG + Intronic
940865387 2:158812716-158812738 GCCCGGGAGTTCAATGTTGCAGG + Intronic
941117636 2:161489792-161489814 GCCCAGGAGTTCAAGGCTACAGG - Intronic
941803388 2:169686492-169686514 GCTCAGAAGTGCAAGGTTGAGGG + Intronic
941815194 2:169789045-169789067 GCCCAGGAGTTCAAGGCTGCAGG + Intergenic
941962624 2:171268919-171268941 GCCCAGGAGTTCAAAGCTGCAGG - Intergenic
942871654 2:180741896-180741918 GCCTAGAAGTTTGAGGTTGCAGG - Intergenic
942967790 2:181917856-181917878 GCCCAGGAGTTCAAGACTGCAGG - Intronic
943068142 2:183110417-183110439 ACCCAGAAGTTGGAGGTTGCAGG + Intergenic
943270601 2:185797763-185797785 GTCCAGGAGTTCAAGGCTGCAGG - Intronic
944827668 2:203501903-203501925 GCCCAGAAGGTCAAGGCTGCAGG - Intronic
945791879 2:214315606-214315628 GCCTGGCAGTTCAAGGTTGCAGG - Intronic
947957261 2:234202881-234202903 ACCCAGGAGTTCAAAGCTGCAGG - Intergenic
1169357677 20:4921507-4921529 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1169370581 20:5026128-5026150 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1169470255 20:5878939-5878961 GCCTAGGAGTTCAAGGTTGCAGG - Intergenic
1169650513 20:7861483-7861505 GCCCAGTAGTTCAAGGCTGTAGG + Intergenic
1170033254 20:11964536-11964558 GCCCAGAAACTCTACATTGCAGG + Intergenic
1170835762 20:19883414-19883436 GCCCAGGAGGTCAAAGGTGCTGG - Intergenic
1171492068 20:25526952-25526974 ACCCAGGAGTTCAAGGCTGCAGG + Intronic
1171722424 20:28577650-28577672 GCCCAGAAGTTCAAGGCTGCAGG - Intergenic
1171755655 20:29105802-29105824 GCCCAGAAGCTCAAGGCTGCAGG + Intergenic
1171787020 20:29477088-29477110 GCCCAGAAGCTCAAGGCTGCAGG - Intergenic
1171860946 20:30402296-30402318 GCCCGGAAGCTCAAGGCTGCAGG + Intergenic
1171999798 20:31765029-31765051 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1172074404 20:32283111-32283133 GCCCAGGAGTTCAAGGCTGTGGG - Intronic
1172082013 20:32349467-32349489 GCCTAGGAGTTCAACATTGCAGG - Intergenic
1172111927 20:32551863-32551885 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
1172440487 20:34962148-34962170 GCCCAGTAGGTCAAGGCTGCAGG + Intergenic
1172495971 20:35384563-35384585 GCCCAGAAGATCGAGGCTGCAGG + Intronic
1172658708 20:36552053-36552075 GCCCAGGAGTTCTAGGCTGCAGG - Intergenic
1173518822 20:43684136-43684158 GCCCAGAAGTTCAACCAGCCTGG - Intronic
1174101661 20:48131347-48131369 GCCCAGGAGTTCAAGGTGACAGG - Intergenic
1174265832 20:49331429-49331451 GCTCAGAAGATCAAGGCTGCAGG - Intergenic
1174430284 20:50463356-50463378 GCCTAGAAGATCAAGGCTGCAGG - Intergenic
1174647970 20:52102444-52102466 GCTCAGATGCTCAAGGTTGCAGG + Intronic
1174783879 20:53414542-53414564 GCCCAGGAGTTCAAGGCTACAGG + Intronic
1175114997 20:56675858-56675880 GCCCAGGAGTTCAAGGCTGGCGG - Intergenic
1175157064 20:56978308-56978330 GCCCAGAATTCCAGCCTTGCGGG + Intergenic
1176071903 20:63231302-63231324 GCCCAGGAGTTGAAGGCTGCAGG - Intergenic
1176209522 20:63911748-63911770 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1178324968 21:31637858-31637880 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1180295975 22:10936335-10936357 GCCCAGAAGTTCAAGTCTGCAGG - Intergenic
1180412696 22:12629670-12629692 GCCCAGAAGCTCAAGGCTGCAGG + Intergenic
1180632034 22:17236329-17236351 GCCCAGGAGTTCAAGGCTGTGGG + Intergenic
1181076382 22:20380337-20380359 GCCCAGAAGTTTGAGGTTACAGG + Intronic
1181488247 22:23245078-23245100 CACCAGAAGGTCAACTTTGCTGG - Intronic
1181587081 22:23858617-23858639 GCCCAGGAGTTCGAAGCTGCAGG + Intronic
1182030326 22:27154324-27154346 GCCCAGGAGTTGAAGGCTGCAGG + Intergenic
1182222305 22:28768399-28768421 GCCCAGTAGTTCAAGGTTGCAGG - Intergenic
1182247571 22:28971781-28971803 GCCCAGGAGTTCAAGGTGACAGG - Intronic
1182710157 22:32317537-32317559 GCCCAGGAGTTTGAGGTTGCAGG - Intergenic
1182910905 22:33983468-33983490 GCCCAGAAGTTTGAGGGTGCAGG - Intergenic
1183868986 22:40726359-40726381 GCCCAGAAGGTGGAGGTTGCAGG + Intergenic
1183887583 22:40897576-40897598 GCCCAGGAGTTCGAGGCTGCAGG - Intronic
1183892519 22:40941623-40941645 GCCCAGGAGTCCAAGGTTGCAGG + Intergenic
1184073540 22:42161872-42161894 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1184631962 22:45788731-45788753 GCTCAGGAGTTCAAAGTTCCAGG - Intronic
1184637889 22:45849845-45849867 GCCCAGGAGTTCAAGGCTGCAGG - Intergenic
1185288998 22:50014758-50014780 GCCCAGAAGCCCAACGGTGAAGG + Intergenic
1185363846 22:50426027-50426049 GCCCAGGAGTTCAAGGTTACAGG - Intronic
949648591 3:6128255-6128277 GCCCAGGAGTTCAAGGCTGCAGG + Intergenic
949993927 3:9601613-9601635 GCCCAGGGGTTCAAGGCTGCAGG + Intergenic
950205803 3:11079575-11079597 GCTGAGAAGTTCAAGGTTGAGGG - Intergenic
950211668 3:11127738-11127760 GCTGAGAAGTCCAAGGTTGCGGG - Intergenic
950379873 3:12603148-12603170 GCCCAGAAGTTCTAGGCTGTAGG - Intronic
950589493 3:13926191-13926213 GCCCAGAAGGAGAAGGTTGCAGG + Intergenic
952413078 3:33066492-33066514 GCCAAGAAGTTCAAGGTGGAGGG - Intronic
952535338 3:34303482-34303504 GCCCAGAAGCTAAAAGTAGCAGG + Intergenic
953005169 3:38971229-38971251 GCCCAGGAGGTCAAGGCTGCGGG - Intergenic
954020768 3:47739395-47739417 GCCCAGGAGTTCAAGGTTACAGG - Intronic
954674774 3:52309739-52309761 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
955141675 3:56275935-56275957 GCCCAGAATGTCAACAGTGCTGG + Intronic
955171675 3:56571793-56571815 GTCCAGAAGTTCAAGGCTGCAGG - Intronic
955251180 3:57284201-57284223 GCCCAGCAGTTCAAGGCTGCAGG - Intronic
955296685 3:57741847-57741869 GCCCAGGAGTTCGAGGCTGCTGG + Intergenic
955321016 3:57974350-57974372 GCCCAGGAGTTCAAGGCTGCAGG + Intergenic
955913814 3:63885803-63885825 GACCAGGAGTTCAACCTAGCCGG + Intronic
956010202 3:64822621-64822643 GCCCAGGAGTTCAGAGCTGCAGG - Intergenic
956295457 3:67707837-67707859 GCCCAGGAGTTTGAGGTTGCAGG - Intergenic
957248909 3:77747854-77747876 GCCCAGAAGTTCAAGGCTGTAGG + Intergenic
957410925 3:79838605-79838627 GCCAAGAAGTCCAAAGTTGAGGG - Intergenic
959260434 3:104072432-104072454 GCCCAGAACTTAAAAGTTGAAGG + Intergenic
959868938 3:111304286-111304308 GCCCAGCAGTTCGAAGTTACAGG + Intronic
959960832 3:112295865-112295887 GCCCAGAAGTTTAAGGTAGCAGG - Intergenic
960045848 3:113197363-113197385 GCTCAGGAGTTCAAGGTTACAGG - Intergenic
960718814 3:120605033-120605055 GCCCAAGAGTTCAAAGTTGCAGG + Intergenic
960968051 3:123119177-123119199 GCCCAGGAGTTTAAGGCTGCAGG + Intronic
962229720 3:133652051-133652073 GCCCAGGAGTTCAAGGTTACAGG + Intronic
962618443 3:137151594-137151616 GCTGAGAAGTTCAAGGTTGAGGG - Intergenic
962981467 3:140494461-140494483 CCCCAGAAGTTAAAAGTTGAAGG - Intronic
963030916 3:140975182-140975204 GCCTTGGAGTTCAAGGTTGCAGG - Intronic
963448954 3:145452895-145452917 GCTCAGGAGTTCAAGGCTGCAGG - Intergenic
963564395 3:146909636-146909658 GCCCAGGAGTTCAAGGCTGCAGG + Intergenic
963742441 3:149094018-149094040 GGCCAGGAGTTCAAGGCTGCAGG + Intergenic
964395025 3:156236269-156236291 TCCCAGAGGTGCAACTTTGCAGG - Intronic
964995476 3:162873095-162873117 GCCCAGAAGTTTAAGGTTTAAGG + Intergenic
965573079 3:170191111-170191133 ACCCAGAAATTCAAGGTTGTAGG + Intergenic
966179696 3:177176901-177176923 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
967057214 3:185840119-185840141 GCCCGGAAGTTCTAGGCTGCAGG + Intergenic
967903101 3:194477278-194477300 GTCTATAAGTTCAACGTTGTTGG - Intronic
968122899 3:196138537-196138559 GCCCAGGAGCTCAAGGCTGCTGG - Intergenic
968266989 3:197370008-197370030 GCCTAGGAGGTCAAGGTTGCAGG - Intergenic
968317706 3:197737963-197737985 GCCCAGGAGTTCCAGGCTGCAGG - Intronic
968670706 4:1849631-1849653 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
968675718 4:1877950-1877972 GCCCAGGAGTTTGAGGTTGCAGG + Intronic
972396131 4:38661356-38661378 GGAAAGAAGTTCAGCGTTGCTGG + Intergenic
973287389 4:48433731-48433753 GCCCAGAAGTCCAAGGTTACAGG - Intergenic
973953795 4:56042674-56042696 GCCCCGAAGTTCAAGGCTGCAGG - Intergenic
973996181 4:56461598-56461620 GTCCAGGAGTTCAAGGCTGCAGG - Intergenic
974050490 4:56937266-56937288 GCCCAGGAGTTCAAGGCTGCAGG - Intergenic
974218527 4:58933017-58933039 GCCCAAGAGTTCAAGGCTGCAGG + Intergenic
975870173 4:78771637-78771659 GCCCAGAAGGTGGAGGTTGCAGG - Intergenic
975990181 4:80251030-80251052 GCCCAGCAGGTGAAGGTTGCAGG + Intergenic
976620207 4:87119492-87119514 GCCCAGGAGTTAAAGGTTGCAGG + Intronic
978593512 4:110351969-110351991 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
978786007 4:112610060-112610082 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
979384736 4:120051536-120051558 GCCCTGAAGTTCAGGGTTTCTGG + Intergenic
980491706 4:133535771-133535793 GCCCAGAAGGTCGAGGCTGCAGG + Intergenic
981722527 4:147815787-147815809 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
982160166 4:152560851-152560873 GCCCAGGAGTTCAAGGCTGCAGG + Intergenic
982266886 4:153545958-153545980 GCCCAGGAGTTCAAAGCTGCAGG - Intronic
983594326 4:169449147-169449169 GCCCAGAAGTTCAAAATGGGCGG + Intronic
984045572 4:174793527-174793549 GCCCAGAAGTTCAACGTTGCGGG - Intronic
984636821 4:182119781-182119803 GCCCAGGAGTTTGAGGTTGCAGG - Intergenic
984654817 4:182306265-182306287 GCCTAGGAGGTCAAGGTTGCAGG - Intronic
985110576 4:186543014-186543036 GCCCAAGAGTTCAAGGCTGCAGG + Intronic
985172314 4:187164749-187164771 GCTGAGAAGTTCAGCATTGCTGG + Intergenic
985256153 4:188071907-188071929 GCCCAGGAGTTCTAGGCTGCAGG + Intergenic
985439811 4:189972760-189972782 GCCCAGAAGCTCAAGGCTGCAGG + Intergenic
985535305 5:461676-461698 GCCCAGGAGTTAAAGGCTGCTGG - Intronic
986027666 5:3865800-3865822 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
986227507 5:5829209-5829231 TCTCAGAATTTCAAAGTTGCAGG + Intergenic
986723164 5:10575008-10575030 GCCCAGGAATTCAAGGCTGCAGG + Intronic
987042983 5:14080297-14080319 GCCCAGGAGGTCGAGGTTGCAGG - Intergenic
987175522 5:15304159-15304181 GGCCAGCAGTTCATCTTTGCAGG + Intergenic
988135176 5:27160984-27161006 GCCCAAAAGTTTGAGGTTGCAGG + Intergenic
990477823 5:56178264-56178286 GCCTAGAAGGTCAAGGCTGCAGG - Intronic
990951602 5:61304194-61304216 GCCCAGGAGTTCAAAGCTTCAGG - Intergenic
991234863 5:64381814-64381836 GCCCAGGAGTTCAAGGGTGCAGG - Intergenic
991606625 5:68408592-68408614 GCCCAGGAGTTCCAGGCTGCAGG - Intergenic
991727767 5:69553049-69553071 ACCCAGGAGTTCAAAGCTGCAGG + Intronic
991867190 5:71074825-71074847 ACCCAGGAGTTCAAAGCTGCAGG - Intergenic
992470906 5:77052274-77052296 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
992694158 5:79268164-79268186 GCCCAGGAGTTCCAGGCTGCAGG + Intronic
993642004 5:90416864-90416886 GCCCAGGAGGTCAAGGTTGCAGG + Intergenic
994982780 5:106898457-106898479 GCCCAGAAGGTCAAAACTGCAGG - Intergenic
996158948 5:120138567-120138589 GCCCAGGAGGTCGAGGTTGCAGG - Intergenic
997067433 5:130578183-130578205 GCTGAGAAGTTCAAAGTTGAGGG - Intergenic
997548895 5:134735194-134735216 GCCCAGGAGTTCAAGGCTGTAGG + Intergenic
997564364 5:134875571-134875593 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
998464699 5:142334072-142334094 GCCCAGGAGTTCATGGCTGCAGG + Intergenic
999756330 5:154667392-154667414 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1001123045 5:168995833-168995855 GCCCAGATGTCCAAGGCTGCTGG - Intronic
1001305533 5:170569665-170569687 GCCTGGAAGTTCAAGGCTGCAGG + Intronic
1002305301 5:178279527-178279549 GCCCAGAACCTCCACGTGGCTGG + Intronic
1002360218 5:178664528-178664550 GCCGAGGAGTTCAGCTTTGCTGG + Intergenic
1003466112 6:6381635-6381657 TTCCAGAAGTTCATGGTTGCTGG + Intergenic
1003910926 6:10742953-10742975 GCCCAGGAGTTCAAAGCTGCAGG - Intergenic
1004951959 6:20683037-20683059 GCCCAGGAGTTCAAGGCTACAGG - Intronic
1004985960 6:21082948-21082970 GCCCAGGAGGTCGAGGTTGCAGG - Intronic
1006038937 6:31237388-31237410 GCCCAGGAGTTCAAGGCTGCAGG - Intergenic
1006310370 6:33253676-33253698 GCCCAGGAGTTCGAGGCTGCAGG + Intronic
1007048592 6:38802318-38802340 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
1010050645 6:71500097-71500119 GCCTAGGAGTTCAAGGTTGCAGG + Intergenic
1010696992 6:78988496-78988518 GCCTAGGAGTTCAAGGCTGCAGG + Intronic
1011421197 6:87175410-87175432 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
1011602687 6:89074737-89074759 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1012844214 6:104368921-104368943 GCCCAGGAGTTTTAAGTTGCAGG + Intergenic
1013136524 6:107287916-107287938 ACCCAGGAGTTCAAGGTTGCAGG + Intronic
1014826152 6:126050620-126050642 GCCCAGGAGTTCAAGGTTACAGG + Intergenic
1015017767 6:128434945-128434967 GCCTAGGAGGTCAAGGTTGCAGG + Intronic
1015537256 6:134279129-134279151 ACTCAGAAGTTCAAGGTTACTGG + Intronic
1015751181 6:136560868-136560890 GCCCAGCAGGTCAAGGCTGCAGG + Intronic
1015769318 6:136752804-136752826 GGGCAGAAGTTCAGCGTGGCTGG + Intronic
1016035575 6:139379411-139379433 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
1016903440 6:149125279-149125301 GCCTAGAAGTTCCACTTTTCTGG + Intergenic
1016928731 6:149381028-149381050 GCCCAGAAGTTTGAGGTTGCAGG + Intronic
1017437873 6:154435070-154435092 GCCCAGGAGGTCAAGGCTGCCGG - Intronic
1017832071 6:158139646-158139668 GCCCAGGAGTTCAAGGCTGTAGG + Intronic
1017840044 6:158214438-158214460 GCCCAGCAGTTCAAGGCTGTAGG + Intergenic
1018597505 6:165498344-165498366 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
1019513818 7:1431064-1431086 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1019746992 7:2706250-2706272 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
1020084314 7:5302464-5302486 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1020543738 7:9496032-9496054 GCCCAGAAGTTTGAAGTTGTAGG - Intergenic
1021117983 7:16765177-16765199 GCCCAGGAGGTCAAGGTTGCAGG - Intronic
1022066875 7:26867463-26867485 GCCCAGGAGTTCAAGATTACAGG + Intronic
1022406030 7:30091085-30091107 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
1023179852 7:37470688-37470710 GCCCGGGAGTTCAAGGCTGCAGG + Intergenic
1024279577 7:47708578-47708600 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1024297762 7:47859553-47859575 GCCCAGGAGTTCAAGTCTGCAGG - Intronic
1024902247 7:54333338-54333360 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1025209974 7:57014734-57014756 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1025244524 7:57306435-57306457 GCCCAGAAGGTCAAGGCTGCAGG + Intergenic
1025287672 7:57679559-57679581 ACCCAGGAGTTCAAGGCTGCAGG + Intergenic
1025661977 7:63562117-63562139 GCCCAGGAGGTCAAGGCTGCAGG + Intergenic
1025723896 7:64040714-64040736 GCCCATGAGTTCAAGGCTGCAGG + Intronic
1025753010 7:64309990-64310012 GCCCATAAGTTCAAGGCTACAGG + Intronic
1025843341 7:65172525-65172547 GCCCAGGAGTTAGAGGTTGCAGG + Intergenic
1025871135 7:65435295-65435317 GCCCAGGAGTTCAAGGCTGCAGG + Intergenic
1026022692 7:66722078-66722100 GCCCAGGAGTTCAAGGTTTCAGG + Intronic
1026494575 7:70891393-70891415 ATCCAGAAGTTCAAAGCTGCAGG - Intergenic
1026510288 7:71021716-71021738 GCCCAGAAGTTCAAGGCTGCAGG + Intergenic
1026552497 7:71380410-71380432 GCCCAGGAGTTCAAGGCTGCTGG - Intronic
1026578879 7:71597429-71597451 GCCCAGAAGTTGGAGGCTGCAGG + Intronic
1026605369 7:71811282-71811304 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
1026879364 7:73899021-73899043 GCCCAGGAGTTTAAGGCTGCAGG + Intergenic
1026892274 7:73989273-73989295 CCCCAGAAGTTCAAGGATGCAGG + Intergenic
1027752800 7:82172527-82172549 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1028379864 7:90187958-90187980 GCCCAGGAGTTCCAGGCTGCAGG + Intronic
1028645739 7:93094599-93094621 GTCCAGAAGTTCAAGGTTGCAGG - Intergenic
1029142053 7:98418339-98418361 GCCCAGGAGTTCAAAGCCGCTGG - Intergenic
1029555896 7:101268807-101268829 GCCCAGGAATTCAAGGCTGCAGG + Intergenic
1030621260 7:111793889-111793911 GCTCAGAAGTTCAGTGTGGCAGG + Intronic
1031536875 7:122945335-122945357 GCCCGGAAGGTCAAAGCTGCAGG + Intergenic
1031934490 7:127722393-127722415 GCCCAGGAGTTTGAAGTTGCAGG - Intronic
1032209887 7:129903827-129903849 GCCCAGGAGTTCAAGGCTACAGG + Intronic
1032300499 7:130682014-130682036 GCCCAGGAGTTCAAGGTTACAGG - Intronic
1033119040 7:138650734-138650756 GCCCAGGAGTTCGAGGCTGCAGG + Intronic
1034405556 7:150900413-150900435 GCCCAGGAGTTCAAGGCTGCAGG - Intergenic
1034648698 7:152671962-152671984 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1034653445 7:152710795-152710817 GCCCAGAAGTTCAACACATCTGG + Intergenic
1035217479 7:157379561-157379583 GCCCAGGAATTCAAGGCTGCAGG - Intronic
1035360275 7:158308021-158308043 GCTGAGAAGTTCAAGGTTGAGGG - Intronic
1035764509 8:2095366-2095388 GCCCAAAAGCTCAAGGCTGCAGG - Intronic
1036722780 8:11192536-11192558 GCCTAGAAGTTCAAGGCTGCAGG + Intronic
1036961970 8:13254357-13254379 ACCCAGAAGTTCATCCTTGCAGG - Intronic
1038085130 8:24187836-24187858 GCCTAGGAGTTCAAGGCTGCGGG + Intergenic
1038592451 8:28852140-28852162 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1038748336 8:30273543-30273565 GCCCAGGAGGTTAAGGTTGCAGG - Intergenic
1038791930 8:30675738-30675760 GACCAGAAGTGCACTGTTGCTGG - Intergenic
1039478670 8:37855665-37855687 GCCCAGGAGTTTAAGGCTGCAGG - Intergenic
1039555922 8:38474915-38474937 GCCCAGGAGTTCAAGGCTCCAGG - Intergenic
1039614885 8:38947544-38947566 GCCCAGAAGTTTGAGGCTGCAGG + Intronic
1042282819 8:67072788-67072810 GCCCAGGAGTTCAAGGCTGAAGG + Intronic
1042373174 8:68016691-68016713 GCCCAGAAGTTTGAGGCTGCAGG - Intronic
1042813119 8:72847377-72847399 TCCCAGAAGGCCAACCTTGCAGG + Intronic
1043456417 8:80416593-80416615 GCCCAGAAGTTTGAGGTTGCAGG + Intergenic
1044163890 8:88955856-88955878 GCCTAGAAGTCCAAGGTTGAGGG - Intergenic
1044743479 8:95350815-95350837 GCGGAGAAGTCCAAGGTTGCTGG + Intergenic
1044993576 8:97817888-97817910 GCCCAGAAGATTGAGGTTGCAGG - Intronic
1046427850 8:114078494-114078516 GCCCAGGAGTTTGAGGTTGCAGG + Intergenic
1048340572 8:133535577-133535599 GGCCAGAAGTTCAAGGCTGCAGG - Intronic
1048842501 8:138578047-138578069 GGCCAGAAGGGCAACTTTGCAGG + Intergenic
1049871168 8:144978274-144978296 GGCCAGAAGTTCAATGCTGTTGG - Intergenic
1049917488 9:332732-332754 GCCCAGGAGTTCAAGGTTGTAGG - Intronic
1050280205 9:4042612-4042634 GCCCAGGTGTTCAAAGTTCCAGG + Intronic
1050324510 9:4486764-4486786 GCCCAGGAGTTTGAGGTTGCAGG - Intergenic
1050324627 9:4487762-4487784 GCCCGGGAGTTCGAGGTTGCAGG - Intergenic
1050543172 9:6687559-6687581 GCCCAGGAGGTCAAGGCTGCGGG - Intergenic
1051683046 9:19627600-19627622 GCCCAGGAGTTTGAGGTTGCAGG - Intronic
1052265682 9:26569597-26569619 GTCCAGGAGTTCAAGATTGCTGG + Intergenic
1052940727 9:34130098-34130120 GCCCAGAAGGTGGAGGTTGCAGG + Intergenic
1053347581 9:37389132-37389154 GCCCAGAGCCTCAACCTTGCTGG + Intergenic
1054833763 9:69654386-69654408 GACCAGGAGTTCAAAGTTTCAGG + Intronic
1055416823 9:76092472-76092494 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1055491224 9:76807144-76807166 GCCCAGGAGTTTAAGGCTGCAGG - Intronic
1055997987 9:82182464-82182486 GCCCAGGAGCTCAAGGCTGCAGG + Intergenic
1056660720 9:88541020-88541042 ACCCAGGAGTTCAAGGTTGCAGG - Intronic
1056770281 9:89473508-89473530 GGACTGAAGTTCAAGGTTGCAGG + Intronic
1056977911 9:91277111-91277133 GCCCAGGAGTTCCAGGTTACAGG + Intronic
1057376057 9:94524133-94524155 GCCCAGGAGGTCAAGGCTGCAGG - Intergenic
1058904471 9:109470617-109470639 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1059153787 9:111972178-111972200 GCCCAGGACTTCAAGGCTGCAGG + Intergenic
1059377657 9:113898501-113898523 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
1059396769 9:114039425-114039447 GCCCAGAAGGTGGAAGTTGCAGG - Intronic
1061199720 9:129130468-129130490 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1061231276 9:129317282-129317304 GCCCGGAAGATCAAGGCTGCAGG - Intergenic
1061233768 9:129330199-129330221 GCCCAGGAGTTCGAGGTTCCTGG - Intergenic
1061383058 9:130270488-130270510 GCCCAGGAGGTCAAGGTTGCAGG + Intergenic
1062014157 9:134282893-134282915 GGCCAGTGGTTCCACGTTGCTGG - Intergenic
1062148094 9:135001838-135001860 GGCCAGAAGCTCAACGCTGATGG - Intergenic
1202802832 9_KI270720v1_random:17354-17376 GCCCAGAAGCTCAAGGCTGCAGG - Intergenic
1185644495 X:1607697-1607719 CCCCAGGAGTTCAAGGCTGCAGG + Intergenic
1185688089 X:1946230-1946252 GCTCAGGAGTTCAAGGGTGCAGG + Intergenic
1185868590 X:3644323-3644345 GCCCAGGAGGTCAACACTGCAGG + Intronic
1186100865 X:6155193-6155215 GCCCAGACGTTCAGCGTGGCTGG - Intronic
1186399854 X:9247574-9247596 ACTAAGAAGTTCAAGGTTGCAGG - Intergenic
1186468451 X:9803003-9803025 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1186764963 X:12761300-12761322 GCTCAGGAGTTCAAGGCTGCAGG + Intergenic
1187860381 X:23676914-23676936 GCCCAGGAGTTCAAGGCTGCAGG - Intronic
1189678984 X:43494556-43494578 GCCCAGGAGTTCAAGGCTGCAGG - Intergenic
1190307511 X:49093614-49093636 GCCCAGGAGTTCGAGGCTGCAGG - Intronic
1191155459 X:57267720-57267742 GCCCAGAAGTTCAGAGATGAAGG + Intergenic
1192126632 X:68506824-68506846 GGCCAGAAGTTGAAGGCTGCGGG - Intronic
1192579052 X:72265756-72265778 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
1194432479 X:93826783-93826805 GCCTGGAAGGTCAAGGTTGCAGG - Intergenic
1195040984 X:101014008-101014030 GCCCAGGAGGTCAAGGCTGCAGG + Intronic
1195778402 X:108433599-108433621 GCCCAGGAGTTGGAGGTTGCAGG - Intronic
1195901333 X:109800584-109800606 GGCCAGAATTTCAAGGCTGCAGG + Intergenic
1196374231 X:115014452-115014474 GATCAGAAGTTCAAAGTTCCTGG - Exonic
1196729471 X:118926544-118926566 GCCCAGAAGGTCAAGGCTACAGG - Intergenic
1196754739 X:119148061-119148083 GCCCAGGAGTTCAAGGCTGCAGG + Intronic
1196846952 X:119904018-119904040 GCCCAGGAGTTCAAAGCTGCAGG - Intronic
1197251453 X:124220267-124220289 GCCCAGGAGTTGAAGGCTGCAGG - Intronic
1198162006 X:134017319-134017341 GCCTAGGAGTTCAAGGCTGCAGG - Intergenic
1198199185 X:134398311-134398333 GCCCAGAATTTCAAGGCTGCAGG + Intronic
1198694042 X:139316705-139316727 GCTCACAAGTTCAAGGTTACAGG + Intergenic
1200387630 X:155908894-155908916 GCCCAGGAGGTCAAGGCTGCAGG - Intronic
1200795581 Y:7338440-7338462 GCCCAGGAGTTCAAGGCTACAGG - Intergenic
1201072918 Y:10165721-10165743 GCCCAGAAGCTCAAACTGGCTGG - Intergenic