ID: 984054517

View in Genome Browser
Species Human (GRCh38)
Location 4:174910378-174910400
Sequence GCCTCCCTCATGGTGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984054514_984054517 17 Left 984054514 4:174910338-174910360 CCAGGTACTCACAGGGAATACTG 0: 1
1: 0
2: 3
3: 33
4: 193
Right 984054517 4:174910378-174910400 GCCTCCCTCATGGTGCTGGCTGG 0: 1
1: 0
2: 4
3: 33
4: 253
984054513_984054517 22 Left 984054513 4:174910333-174910355 CCACACCAGGTACTCACAGGGAA 0: 1
1: 1
2: 8
3: 52
4: 225
Right 984054517 4:174910378-174910400 GCCTCCCTCATGGTGCTGGCTGG 0: 1
1: 0
2: 4
3: 33
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984054517 Original CRISPR GCCTCCCTCATGGTGCTGGC TGG Intronic
900171375 1:1270788-1270810 GCCTCTGTCAAGGGGCTGGCAGG - Intronic
900653951 1:3745854-3745876 GCCTCCCACAGGGTGCTCCCCGG - Intergenic
900766672 1:4510576-4510598 GCCTCCTTCATGGAGCTGGAAGG - Intergenic
900876890 1:5349247-5349269 GCCTCCCTCCCGAAGCTGGCAGG + Intergenic
901176476 1:7303053-7303075 GCCTTCCTCTTGGTGCTGCTGGG + Intronic
902227242 1:15004141-15004163 GCCAACCTCATGGTGCTGTCTGG + Intronic
903060716 1:20666631-20666653 GCCCCCCTGTTGGAGCTGGCAGG - Intronic
903066427 1:20702277-20702299 ACCTCAGTCATGCTGCTGGCTGG + Intronic
903419806 1:23210517-23210539 GACTCCCTCATGATGCTGACAGG + Intergenic
903679555 1:25088046-25088068 GCCTGCCTCATGGGGCTGTGAGG + Intergenic
904866242 1:33581108-33581130 GCCTACCTCTAGGGGCTGGCAGG + Intronic
905258294 1:36699891-36699913 CCCTGCCTCATGGTGCTTTCTGG - Intergenic
906729278 1:48067188-48067210 GGCTGCCTCATGGGGCTGACAGG - Intergenic
906744009 1:48208880-48208902 GCATCCCTCCTGGTGGTGGGTGG - Intergenic
908066644 1:60413387-60413409 CCCTTCCTAATGGTGCTGGATGG - Intergenic
908288884 1:62641287-62641309 TCCTGGCTCATGGTGTTGGCTGG - Intronic
912155635 1:106915277-106915299 GCCTCCCTCATGCTGCTGAAAGG + Intergenic
912382434 1:109254715-109254737 GCCTCACTCAGGGTCCTTGCTGG + Intronic
912911010 1:113759206-113759228 GCCGCCCTCAGGGCGCTGGGCGG - Exonic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
919744581 1:201000465-201000487 GCATCCTCCATGGAGCTGGCAGG + Exonic
920077563 1:203348239-203348261 ACCTCCCTCCTGCTGCTGGCAGG - Exonic
920387604 1:205579845-205579867 GCCTCAGTCATGGCGCTGGCGGG + Exonic
920501307 1:206487059-206487081 TCCACCCTCATGTTCCTGGCGGG + Intronic
922886481 1:229024673-229024695 GATGCCCTCATGGTGCTGCCTGG + Intergenic
923564795 1:235068661-235068683 ACCTCCCTCAAGGGGCTCGCAGG + Intergenic
1063073653 10:2692306-2692328 GCCTCTCTCATGATTCAGGCAGG + Intergenic
1063233491 10:4088788-4088810 ACTTCCCTCATGGTGCTGTGAGG - Intergenic
1065155166 10:22862250-22862272 GCCTTCCTCTTGGGTCTGGCTGG - Intergenic
1067272089 10:44801180-44801202 TCATTCCTCATTGTGCTGGCTGG - Intergenic
1067555460 10:47266683-47266705 GCATCCCCCATGGTGCTGCATGG + Intergenic
1069321795 10:67180964-67180986 TACTTCCTCATGGTGCTGTCAGG - Intronic
1069664119 10:70143694-70143716 GCCTCCCTTTTTGTGCTGGTGGG - Intronic
1071465349 10:85934792-85934814 TCCTCCCTCCTGGAGCTGCCTGG - Intronic
1072211472 10:93250411-93250433 TCCTCCCTCATGGGGCTGTTGGG - Intergenic
1072690482 10:97569658-97569680 TCCGGCATCATGGTGCTGGCTGG + Intronic
1072761130 10:98057725-98057747 GTCTACCTCATGGTACTGCCAGG + Intergenic
1073538421 10:104298305-104298327 GCCACCCTCATGGTGGGTGCTGG + Intronic
1073793274 10:106961229-106961251 GCCTGTCTTATGCTGCTGGCAGG - Intronic
1075017145 10:118918198-118918220 GCCTCACTCAAGTTGCAGGCTGG - Intergenic
1075729716 10:124628931-124628953 GCCTCCCTGAAGGTTCTTGCTGG + Intronic
1075736448 10:124667402-124667424 GCCTTCCTCATGGGGCTATCTGG + Intronic
1075777631 10:124998569-124998591 GTCTCCCTCATGGAGCTGGCAGG + Intronic
1076170439 10:128314896-128314918 GCCTCCCTAATGGTGGGGGAGGG - Intergenic
1076177513 10:128379489-128379511 GACGCCCTGCTGGTGCTGGCCGG + Intergenic
1076404841 10:130204877-130204899 GCCTCCCTGAGGGTGATGGGGGG + Intergenic
1076734549 10:132452846-132452868 GCCTCCTGCACGGTGCTGGGTGG - Intergenic
1077104510 11:836347-836369 GCCTACATCCTGGTGGTGGCGGG + Exonic
1077479722 11:2807885-2807907 GCTTCCCTCATGCTGCAGCCAGG - Intronic
1077485307 11:2835794-2835816 GCCTTCCTCATGGAGGCGGCGGG + Intronic
1078269858 11:9785215-9785237 TCCTCCCCCATGCTGCTGTCTGG + Exonic
1078836549 11:15035488-15035510 GCCTGCTCCATGGTGCAGGCTGG + Intronic
1082758021 11:57097216-57097238 CCCTCCCTCATGGTGGTCCCTGG + Intergenic
1083679307 11:64343922-64343944 CCCTCCCCCAGGGTCCTGGCCGG + Intronic
1083864511 11:65446243-65446265 GCCTCCCTCTTGGGGATGGGAGG - Intergenic
1084153443 11:67301826-67301848 GAGCCCCTCATGGGGCTGGCTGG + Intronic
1085314345 11:75535297-75535319 ACCACCCCCATGGTACTGGCTGG - Intergenic
1085439539 11:76546088-76546110 TCCACCCACATGGTGGTGGCAGG + Exonic
1085445188 11:76596769-76596791 CCCTGCCTCCTGGTGCTCGCTGG - Intergenic
1087515423 11:99154084-99154106 GCCTTCACCAGGGTGCTGGCAGG + Intronic
1088762609 11:112946758-112946780 AACTCCCTCATGCTGCTGGGAGG + Intergenic
1089217553 11:116843955-116843977 GCCATCCTGATGTTGCTGGCGGG - Intronic
1091753834 12:3039091-3039113 GTCTCCTCCCTGGTGCTGGCCGG - Intronic
1091845953 12:3656556-3656578 TCCTCCCTGATGGGGCAGGCAGG - Intronic
1092148736 12:6232655-6232677 GGCGCCCTCATGATGCTGGTGGG + Exonic
1092633097 12:10406826-10406848 GCTTGCCTAATGTTGCTGGCAGG - Intronic
1092946444 12:13458451-13458473 TGCTCCCTGATGGTGCTGGGAGG + Intergenic
1093865904 12:24227218-24227240 GACACCCTCTTGGTGCTGGCAGG - Intergenic
1098989350 12:77047791-77047813 GCCTGCCGGAAGGTGCTGGCAGG + Intronic
1099765853 12:86982597-86982619 AGCTCACTCCTGGTGCTGGCTGG - Intergenic
1099945449 12:89238786-89238808 GCCTGCATCATACTGCTGGCTGG - Intergenic
1101718407 12:107331305-107331327 CCCGCCCTCATGGAGCTTGCAGG + Intronic
1102298294 12:111753886-111753908 GCCCACCTCATGGACCTGGCAGG + Exonic
1103019857 12:117525269-117525291 GCCTCCCTCATGGTCCTGCTGGG + Intronic
1103339459 12:120213762-120213784 GTCTTCCTCATTGTGCTGTCTGG - Intronic
1103824053 12:123721794-123721816 GCCTGGCTCTTGGTGCTGGGTGG + Intronic
1104063263 12:125285718-125285740 GTCTCCCTCATGTTGCTACCAGG - Intronic
1104642730 12:130477847-130477869 GCCTCCCGCCCGGTGCTGGCTGG - Intronic
1104832900 12:131766564-131766586 GCTGCCCTTATGGGGCTGGCAGG + Intronic
1104944127 12:132408094-132408116 GCCTCCGTCATGTGGCTGGTGGG - Intergenic
1105606096 13:21927619-21927641 GCCTCCCTCATCCTTCTTGCTGG - Intergenic
1105988853 13:25597599-25597621 GCCTTCCTCAGGTTGTTGGCAGG - Intronic
1112147516 13:96717649-96717671 GCCTCCCTCATGGAGTTGTGAGG - Intronic
1113553722 13:111214299-111214321 GCCTCAGCCCTGGTGCTGGCTGG + Intronic
1119294592 14:73522674-73522696 GCTTCCCGGACGGTGCTGGCTGG + Exonic
1119342013 14:73887042-73887064 GCATCCCTCCTGGATCTGGCGGG + Intronic
1119878278 14:78078662-78078684 GCCTCCCTGAAGGTGAGGGCTGG - Intergenic
1120758285 14:88264421-88264443 GTCTCTGTCATGGTGCAGGCTGG + Intronic
1121551813 14:94808542-94808564 GCCTCCCTACTGAGGCTGGCAGG - Intergenic
1122030329 14:98907360-98907382 CCCTCCCCCATGCTGCCGGCAGG - Intergenic
1122235980 14:100330820-100330842 CCCTCCCTCTTGGAGCTGTCAGG - Intergenic
1122256634 14:100482945-100482967 GCCTCCTCCATGTTTCTGGCTGG + Intronic
1123016283 14:105377184-105377206 GGGTCCCCCAGGGTGCTGGCTGG + Intronic
1124416506 15:29476798-29476820 ACCTCTCACATGCTGCTGGCGGG + Intronic
1124630137 15:31331510-31331532 TCCTCCCTGATGCTGCTGCCTGG + Intronic
1128252377 15:66172282-66172304 GCCTCCCTCCAGGAGCTGGAAGG + Intronic
1128313166 15:66644384-66644406 GCCTCCCACATTGTCCTGGCTGG + Intronic
1129191858 15:73942048-73942070 GCCTCCCTCAGGTTGGTGGCCGG + Intronic
1129725295 15:77898540-77898562 TCCTCCCTCATGGTGCCTGAGGG + Intergenic
1130146876 15:81281199-81281221 GCCTCCCTCATGGGACTGCTGGG + Intronic
1130725302 15:86432922-86432944 GTCTCCCTCAGGGTTCTGGCAGG + Intronic
1132669444 16:1096624-1096646 ACAGCCCTCATGCTGCTGGCGGG + Intergenic
1132931224 16:2460136-2460158 GCCGCCTTCATGCTGCCGGCGGG + Exonic
1132975881 16:2711016-2711038 GAGTCCCTCCTGGAGCTGGCAGG + Intergenic
1133102274 16:3486588-3486610 CCCTCCTTGACGGTGCTGGCAGG + Exonic
1133113780 16:3564653-3564675 GCCTCCCTCCTGCTGGTGGAGGG - Exonic
1133578437 16:7117835-7117857 AGCTCCCTCAGGTTGCTGGCAGG + Intronic
1134070162 16:11255762-11255784 GCCCCCCTCTCGGTGCTGCCCGG - Intronic
1135559174 16:23462061-23462083 CCCTCCCTCTTGGTGGTTGCTGG - Intergenic
1136235988 16:28914095-28914117 GCCCCCCTCCTGGTGAAGGCAGG - Intronic
1136993534 16:35172329-35172351 GCTTCCCCCATGGTGCTGATAGG + Intergenic
1138460878 16:57146950-57146972 GCCACCCCCATACTGCTGGCTGG + Intronic
1140911962 16:79462247-79462269 GCCTCCCTCATAGAACTGGTGGG - Intergenic
1141588579 16:85051734-85051756 GACTCCCTAACGATGCTGGCGGG + Intronic
1141825339 16:86475197-86475219 ACCTACCTCATGGTGTTGGTGGG - Intergenic
1142534012 17:601059-601081 GCCTCCCTTTTGGTGGTGTCTGG + Intronic
1143662337 17:8333527-8333549 GCTTCCCTGATGGTGCTGCAAGG + Intergenic
1143850587 17:9808829-9808851 GCCATCTTCATGGTGCTGGCAGG - Exonic
1144877960 17:18412187-18412209 GCCCAGCTCATGGGGCTGGCTGG - Intergenic
1145154269 17:20532238-20532260 GCCCAGCTCATGGGGCTGGCTGG + Intergenic
1145318565 17:21749561-21749583 GGCTCACACATGGGGCTGGCAGG - Intergenic
1145827009 17:27884621-27884643 GCCCCGCTCATGGTGCTGCCAGG + Intronic
1146183979 17:30713049-30713071 ACCCCCCGCATGGTGCTGGGTGG - Intergenic
1148100362 17:45086580-45086602 GCCTCCTCCATGGTTTTGGCAGG - Exonic
1148640589 17:49184261-49184283 GCCTCCCTGATGCAGCTGGCAGG + Intergenic
1149491963 17:57091526-57091548 GCCTGCCTCCTGGTGCAGGCAGG + Intronic
1151102229 17:71569271-71569293 GCCTCCCTTCTGGTTCTGGAAGG + Intergenic
1151674371 17:75590042-75590064 GTCTCCCTCCTGCTGCAGGCGGG - Intergenic
1153723839 18:7936089-7936111 GCCTGCTTCATGGGGCTGGCGGG + Intronic
1154066368 18:11110740-11110762 GCCTCCGTCAAGCTGATGGCAGG + Intronic
1158314007 18:56190500-56190522 GCCTCCCTCTTGGGGGTGGTGGG - Intergenic
1160033439 18:75281505-75281527 GCCACCCCCATGGTGCTTTCAGG - Intronic
1160048198 18:75407206-75407228 GCCTCCCTCATGATGCGGGAAGG + Intronic
1160412333 18:78683482-78683504 GCCTCACTCCTGCTGCTGCCTGG - Intergenic
1160594001 18:79961962-79961984 GGCTCCCTCGTGGTGGGGGCAGG - Intergenic
1161350792 19:3790376-3790398 GTCACCCTCCTGGTGCAGGCTGG + Intronic
1162974807 19:14202639-14202661 GCCCCCTGCATGGTGCTGGGTGG + Intronic
1163476508 19:17529191-17529213 GCCTAGCTCATGGGGCTGGGGGG + Intronic
1163674990 19:18651248-18651270 GCCTTCCTGGTGGTGTTGGCAGG - Intronic
1163798265 19:19349499-19349521 GCCACCCTTAGGGTGCTGGCCGG - Intronic
1164438094 19:28249833-28249855 GCCTCCCTCATCACGCTGACAGG + Intergenic
1164537734 19:29098960-29098982 GCCCCCATGATGCTGCTGGCTGG + Intergenic
1164575668 19:29404056-29404078 TCCTCCCTCATGGGGCTTGTTGG + Intergenic
1165104452 19:33460742-33460764 GCCTCCCACAGGGTGCTGAGTGG - Intronic
1165761564 19:38324538-38324560 TCCTCCCTCCTCTTGCTGGCTGG - Intronic
1166095683 19:40537600-40537622 ACCTCCCTCATGGGGCTGTTGGG - Intronic
1166122447 19:40693700-40693722 GCCTTCCTCATGGGGCTGTTGGG + Intronic
1166256070 19:41605756-41605778 TCCACCCTCCTGGTGGTGGCAGG - Intronic
1166520038 19:43474203-43474225 CCCTCCCTGATTGTCCTGGCAGG - Intergenic
1168182615 19:54672365-54672387 GCCTCCCTCTTGGTGCAACCAGG + Intronic
926366760 2:12140365-12140387 GTCACCCTCACGGTGGTGGCTGG + Intergenic
928115258 2:28541660-28541682 GCCTCGCTCATGTTCCTGGATGG + Intronic
928359810 2:30654117-30654139 GCCTCAGTCATGTGGCTGGCAGG + Intergenic
929501155 2:42493039-42493061 GGCTCCCTCCAGGCGCTGGCTGG - Exonic
932343305 2:70979867-70979889 GCCTCCCTCCTGAAGCAGGCTGG - Intronic
934661021 2:96143782-96143804 GCCTGCCCCACTGTGCTGGCAGG - Exonic
934947238 2:98550625-98550647 GCCGCCCTCATGTGGCTGCCTGG + Intronic
935855612 2:107269693-107269715 GCCTGCCTCGTGGTGCTGGCAGG - Intergenic
937129113 2:119494068-119494090 ACCTCACTCATGGAGCTGGCAGG + Intronic
937813704 2:126227428-126227450 ACCTCCCACATGTTGCTGGTGGG + Intergenic
938624405 2:133092432-133092454 GCTTCAATCAAGGTGCTGGCAGG - Intronic
940949965 2:159662450-159662472 ACCTCTCATATGGTGCTGGCAGG - Intergenic
941704728 2:168645689-168645711 GCCTCCCTGACGGTGGTGGGTGG - Intronic
942076190 2:172359109-172359131 GTCTCCCTCAGGGTGCTGGCTGG + Intergenic
948899669 2:240949923-240949945 GCCTCCCTCATGGAAGAGGCTGG + Intronic
948911912 2:241009145-241009167 GCATCTCTGATGGTGGTGGCTGG + Intronic
1169328726 20:4699393-4699415 GGCAGCCTCATGGTGGTGGCTGG + Exonic
1169328734 20:4699417-4699439 GGCAGCCTCATGGTGGTGGCTGG + Exonic
1169328751 20:4699465-4699487 GACAGCCTCATGGTGGTGGCTGG + Exonic
1169448353 20:5690759-5690781 GCCTCACTCAAGGTGGTGACAGG - Intergenic
1169525283 20:6417653-6417675 CCCTTCCTCATTGTCCTGGCTGG - Intergenic
1170460317 20:16571580-16571602 GCATTCCTCAGGGTGCTGTCTGG - Intronic
1170477525 20:16730402-16730424 GGCTCCCTTTTGGTGGTGGCGGG + Intronic
1171318299 20:24215424-24215446 AACTCCCTCATGCTTCTGGCAGG + Intergenic
1172653769 20:36524452-36524474 GGCTTCCTCATGGTGCTGGAAGG + Intronic
1173254501 20:41384581-41384603 GCCTCTATCAAGGTGTTGGCAGG + Intergenic
1175159037 20:56994372-56994394 GCCTCCCTCAGGGCCCTGGGTGG - Intergenic
1175166688 20:57049063-57049085 GCCTCCCTCATGCCTCTGGTGGG - Intergenic
1178186382 21:30226726-30226748 TCCTCCCTCAAGGAGCTTGCAGG + Intergenic
1178916014 21:36705940-36705962 GCCTTCCTCTGGGTGGTGGCAGG - Intronic
1179646104 21:42777288-42777310 GGCTGCCTCCTGGTGCGGGCAGG - Intergenic
1179655942 21:42844850-42844872 GCCAGCCTCATGGTGGGGGCGGG - Intronic
1181275762 22:21686706-21686728 CCCAGCCTCATGGGGCTGGCAGG - Intronic
1181311270 22:21946172-21946194 ACCTGCCACATGGTGCTTGCAGG - Intronic
1181635465 22:24172369-24172391 GCCTCCCTCAGGGCACTGGGAGG + Intronic
1181888022 22:26037145-26037167 GCCTCCCAGATGGAGCAGGCAGG - Intergenic
1183371045 22:37432672-37432694 GCTTCCCTCACGTGGCTGGCAGG + Intergenic
1184886918 22:47352127-47352149 GCCTTCCTCAGGCTGCAGGCTGG + Intergenic
1185308347 22:50136598-50136620 GGCTCCCTCTTGGTGCTCTCTGG - Intronic
1185333116 22:50260483-50260505 GCCTCTCCCATGGCGGTGGCTGG - Intronic
950046281 3:9950224-9950246 GCCTTCCTCAAGGGGCTGACAGG + Intronic
950892055 3:16412895-16412917 GCCTCCCTCAGTTTGTTGGCAGG - Intronic
952762848 3:36930341-36930363 GACTCACTCATGTTGTTGGCAGG - Intronic
953339117 3:42118959-42118981 ACCTGCCTCATGTTGCAGGCTGG + Intronic
954314656 3:49794628-49794650 GCCTCCATCCTGGTGCTCGATGG - Exonic
958798812 3:98733160-98733182 GCCACCTCCTTGGTGCTGGCAGG - Intronic
960211539 3:114973432-114973454 GCCTCGATCTTGGGGCTGGCTGG + Intronic
961371429 3:126434139-126434161 GCTTCCAGCAGGGTGCTGGCAGG - Intronic
962216180 3:133523882-133523904 GCTTACCTCATGGGGCTGCCTGG - Intergenic
967877535 3:194277298-194277320 GCCTTCCTCATGTTGCAGGGTGG - Intergenic
968471288 4:783517-783539 ACCTTCCTGATGCTGCTGGCTGG - Intergenic
968518471 4:1024643-1024665 GCCTTCCTCACCGTGCTGCCAGG + Exonic
968647450 4:1747797-1747819 TCCGCCATCAGGGTGCTGGCGGG - Intergenic
968681934 4:1927099-1927121 CTCTCACTCATGCTGCTGGCAGG + Intronic
968813598 4:2810797-2810819 GCCTGCCTCATCGTCCAGGCTGG + Intronic
969046846 4:4342533-4342555 GCATCCTTCATGGTGCCTGCTGG - Intergenic
972980207 4:44689385-44689407 GCCTTGCTCTGGGTGCTGGCTGG + Exonic
975367186 4:73543823-73543845 GCCTGGCTCATGATGTTGGCTGG + Intergenic
975644299 4:76530807-76530829 GCCTCCATCCTGTGGCTGGCTGG + Intronic
980714337 4:136611986-136612008 GCCTGGCTCATGAAGCTGGCAGG - Intergenic
984054517 4:174910378-174910400 GCCTCCCTCATGGTGCTGGCTGG + Intronic
985063514 4:186100903-186100925 GCCTTCTTCATGGGGCTGGCTGG + Intergenic
985659669 5:1150795-1150817 GCCTGCCCCGTGGGGCTGGCAGG + Intergenic
985713441 5:1442874-1442896 GCCTCCCTGAGCATGCTGGCCGG - Intronic
985784866 5:1888127-1888149 CCCTCCCTCAGGGAGCTGGGGGG + Intergenic
986228617 5:5840931-5840953 GCATTCCTCATGGTGCTGGGGGG - Intergenic
986687824 5:10289563-10289585 TCCTCCCTCAAGGGGCTGCCAGG + Intronic
989678216 5:43997779-43997801 GCCTCCCGCCTGCTGCAGGCAGG + Intergenic
990544122 5:56805159-56805181 GGCTCCCTTATGCTGCTGGTAGG - Intergenic
998082576 5:139289076-139289098 GCTTCCCTCATGATGTTGGCCGG - Intronic
998749774 5:145307293-145307315 GCCTCCCTCAGGGTGAGGACTGG - Intergenic
999230610 5:150059744-150059766 GCCTCCCTCGGGGTCCTGGCCGG + Exonic
999824076 5:155257675-155257697 GCCTCACTCCTGTTGCTGGAGGG + Intergenic
1002133005 5:177092763-177092785 GCCTGGCTCACGGTGCTGCCAGG + Exonic
1002140735 5:177136358-177136380 CCTGCACTCATGGTGCTGGCAGG - Intronic
1003561311 6:7183098-7183120 TCCTCCCCCATACTGCTGGCAGG - Intronic
1004330382 6:14715571-14715593 TTCTCCCTAATGGAGCTGGCTGG - Intergenic
1004707602 6:18139098-18139120 GCGTCCCCCATGGTGCATGCTGG + Intronic
1005419886 6:25638071-25638093 GCCTCCCTCACCTGGCTGGCAGG - Intergenic
1006403308 6:33830112-33830134 GCCTCCCTCATGTCCCTGGGTGG + Intergenic
1012230241 6:96752290-96752312 GAGTCCCTCATGGTGATGGCAGG - Intergenic
1013639489 6:112059374-112059396 GCCTCCCTTCTGGAGGTGGCAGG + Intronic
1019286129 7:223998-224020 ACCCCCGTGATGGTGCTGGCGGG - Intronic
1019428350 7:987669-987691 GCCTCCCTCCTGCTCCTGGCTGG - Intronic
1019469638 7:1211844-1211866 GCCTCCTGCATGGGGCTGCCGGG - Intergenic
1019525038 7:1477045-1477067 GGCCCCGTCATGGTGCTGGAGGG + Intronic
1021359185 7:19690575-19690597 GACTCCCTGATGGTCCTGCCTGG - Intergenic
1021508571 7:21411137-21411159 GCCTGCCTCTTGGTGGAGGCAGG + Intergenic
1023758758 7:43444607-43444629 GGCTCCTCCTTGGTGCTGGCTGG - Exonic
1024281910 7:47725358-47725380 GCCTGCCCCATGCTGCTGGCAGG + Intronic
1029517166 7:101032080-101032102 GCCACCTTCATGGTGCTGGCAGG - Exonic
1029517206 7:101032434-101032456 GCAACCGGCATGGTGCTGGCAGG - Exonic
1033816756 7:145083003-145083025 GCCCTGCTCATGGGGCTGGCTGG - Intergenic
1034873847 7:154707287-154707309 GCTTGCCTCATGGTGCTGTGGGG - Intronic
1035042393 7:155938671-155938693 GCCTCCCTTATTGAGCTGGCTGG - Intergenic
1035469881 7:159102937-159102959 GCCACCCACACGGTGCTGCCAGG + Intronic
1039361463 8:36881763-36881785 GCCTACCTCATGGTGTTGCTGGG + Intronic
1039583210 8:38683593-38683615 GCCTCCGCCGTGGTGCTGGCTGG + Intergenic
1040111137 8:43567669-43567691 ACCTCCCTCATGTTGGTCGCGGG + Intergenic
1040392530 8:46962045-46962067 GCAGCCCTCATGGTCCTTGCTGG - Intergenic
1041174769 8:55183957-55183979 GCATCCTTGATGGAGCTGGCAGG - Intronic
1042749488 8:72142577-72142599 ACATCCCTCTTGGTGATGGCTGG - Intergenic
1042839398 8:73108550-73108572 GTCCCACCCATGGTGCTGGCAGG - Intronic
1043600233 8:81928698-81928720 CCCTCCATGCTGGTGCTGGCTGG - Intergenic
1043857112 8:85276033-85276055 GGCTCCCTCAGGTTGCTGGGAGG + Intronic
1045064839 8:98435804-98435826 GGCTCCCTCAGGGTGCTGCCTGG - Intronic
1047093650 8:121600468-121600490 ACCTCCGTCATGGTCCTGGAAGG + Intergenic
1048298478 8:133234127-133234149 GCCTGCCTCGTGGGGCAGGCTGG + Intergenic
1049369031 8:142254709-142254731 GCCCCCATCATGCAGCTGGCAGG - Intronic
1049560320 8:143307004-143307026 GGCTGCCTCATGGGGTTGGCGGG + Intronic
1049577676 8:143397214-143397236 GACTCCCACAGGGTGCTGGGCGG + Intergenic
1050235254 9:3571306-3571328 GCCTCCCTTATGATGCTCACTGG - Intergenic
1050335849 9:4589413-4589435 TCCTACCACGTGGTGCTGGCTGG + Intronic
1052743248 9:32414655-32414677 GCCATCCTCCTGGTGCTGGAGGG + Intronic
1052982298 9:34458253-34458275 TCCTCCATCATGGTGCCGGCGGG + Exonic
1053132195 9:35622255-35622277 GTCTCCCTCATGGTGCAATCAGG - Intronic
1053306040 9:36985604-36985626 GGCTGCCTCATGGAGATGGCTGG - Intronic
1053439828 9:38107135-38107157 GCCTCCCTCACAGTTTTGGCCGG + Intergenic
1055969942 9:81901740-81901762 GCCCTCCTCTTGGTGCTGGTAGG + Intergenic
1056539261 9:87557230-87557252 GCATTCCTCATGGGGCTGCCTGG - Intronic
1056845413 9:90033148-90033170 GCTTACCTCCTGGTGGTGGCAGG + Intergenic
1057860290 9:98635463-98635485 GTCTCCCTCATGGTTGTTGCGGG - Intronic
1058439507 9:104993853-104993875 GCCTGCCTGCTGGTGTTGGCAGG + Intergenic
1058945703 9:109853999-109854021 GCCAAGCACATGGTGCTGGCAGG + Intronic
1060222343 9:121771424-121771446 GTCTCCCCCAAGGTGGTGGCAGG + Intronic
1061083551 9:128386261-128386283 GCCTCCATCTTGGTACTGTCTGG - Intronic
1062409684 9:136417059-136417081 CCCGACCGCATGGTGCTGGCCGG + Exonic
1062526835 9:136981324-136981346 GCCTCCCTCCTGGGGGTGGTGGG - Intronic
1062567986 9:137171704-137171726 GCCCTCCTTGTGGTGCTGGCGGG - Exonic
1185625168 X:1476096-1476118 TCCTCCCTCCTGGAGCTGGAAGG - Intronic
1185852438 X:3501663-3501685 GCCTCTCCCATGGTTCTGGGTGG + Intergenic
1188345799 X:29064042-29064064 GACTCCCTCTTGCTGCTGGTTGG - Intronic
1188512424 X:30950631-30950653 GCTTCCAGCATGGTGCTGGCTGG + Intronic
1189134456 X:38534207-38534229 ACCTCTTCCATGGTGCTGGCTGG + Intronic
1191611231 X:63115396-63115418 CCCTCCCTGATGTTGGTGGCAGG - Intergenic
1192248006 X:69389125-69389147 GCCTCCCAAAAGGAGCTGGCTGG + Intergenic
1193240687 X:79165657-79165679 GCCTCACTCCAGGTTCTGGCCGG - Intergenic
1197775257 X:130114582-130114604 GCTCCGCTCATGGTGCAGGCTGG - Intergenic
1198883326 X:141306037-141306059 GCCTGCCTCAGGGTGATGGTAGG + Intergenic
1200123137 X:153800661-153800683 GCCTCCCTCTAGCTGCTGGGGGG - Intergenic
1201731329 Y:17207016-17207038 ACCTACCTCATGTAGCTGGCTGG + Intergenic