ID: 984055832

View in Genome Browser
Species Human (GRCh38)
Location 4:174928331-174928353
Sequence AGCTGGCAAAAAACATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 8, 1: 6, 2: 6, 3: 11, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984055832_984055833 -10 Left 984055832 4:174928331-174928353 CCTGGAGATGTTTTTTGCCAGCT 0: 8
1: 6
2: 6
3: 11
4: 195
Right 984055833 4:174928344-174928366 TTTGCCAGCTTTGTTATGCAAGG 0: 4
1: 10
2: 9
3: 30
4: 140
984055832_984055835 27 Left 984055832 4:174928331-174928353 CCTGGAGATGTTTTTTGCCAGCT 0: 8
1: 6
2: 6
3: 11
4: 195
Right 984055835 4:174928381-174928403 AACCGCATCCTGTAACTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984055832 Original CRISPR AGCTGGCAAAAAACATCTCC AGG (reversed) Intronic
900522545 1:3112724-3112746 AGCTGGCAGAAACCCTCACCGGG - Intronic
900615577 1:3564268-3564290 AGCTGGCAAAAAACATCTCTAGG - Intronic
901306645 1:8237642-8237664 AGCTGGCCAAAATGATCTACAGG + Intergenic
904967542 1:34388832-34388854 AGCTGCCAAAAAATATTTCTAGG - Intergenic
905189957 1:36225795-36225817 GGCTCACAAAATACATCTCCCGG - Intronic
905518212 1:38577843-38577865 AGCTGGCTAAAAATTCCTCCTGG - Intergenic
906505656 1:46377522-46377544 ATGTGGGAGAAAACATCTCCTGG - Intergenic
908752501 1:67437844-67437866 AGGTGGGACAAAACATGTCCAGG + Intergenic
908950070 1:69549995-69550017 ATCTGGCAAAGAAGAACTCCGGG + Intergenic
908983906 1:69993239-69993261 AGCTTGAAAACAACATCACCTGG - Intronic
909092984 1:71250410-71250432 AGCTGGCAAGGCACATCTTCTGG - Intergenic
910807163 1:91200217-91200239 AGCTGGCAAAAGACAGCTTCTGG - Intergenic
911393535 1:97276484-97276506 AGCTGGCAAAAGACATGAACAGG + Intronic
912152531 1:106878146-106878168 AGCTGGCAAAAAACATCTCCAGG + Intergenic
914970616 1:152305589-152305611 AGCAGGCACAAGACAGCTCCAGG - Exonic
914970771 1:152306561-152306583 AGCAGGCACAAGACAGCTCCAGG - Exonic
915321730 1:155060257-155060279 AGCTGGCACCAAGCATCACCAGG - Exonic
917844359 1:179008070-179008092 AGCTGGCAAAGAAGACCTCATGG - Intergenic
918189255 1:182156298-182156320 AGCTGGCCAAATCCATCTTCAGG - Intergenic
920070645 1:203300591-203300613 AGCTGATAAGAAACATCACCCGG - Intergenic
920537829 1:206751422-206751444 AGCTGGCAACAAACAGATCATGG + Intergenic
921204436 1:212836083-212836105 AGTAAGCAAACAACATCTCCTGG - Exonic
921449648 1:215290064-215290086 AGGTGGCAAAGAACCTCTCATGG - Intergenic
921756509 1:218862883-218862905 AGTTGACAAAAACCATCTCAAGG + Intergenic
922568485 1:226617512-226617534 AGCTGACAGCAAACCTCTCCTGG - Intergenic
923196824 1:231676352-231676374 AGCTGGGAAATAACAGTTCCAGG - Intronic
924731223 1:246713369-246713391 AGCTGACAAAGATCCTCTCCTGG - Intergenic
1063231596 10:4070921-4070943 AGCTGTAAAAAATCATCTCATGG - Intergenic
1066105303 10:32151164-32151186 AGCTGGCCAATCATATCTCCTGG - Intergenic
1067531958 10:47080614-47080636 AGATGGCCAAGAACCTCTCCTGG + Intergenic
1067943480 10:50675911-50675933 AGCTGAGAAAGAACATCTCAGGG - Intergenic
1069175501 10:65284555-65284577 AGAAGGCAAAAATGATCTCCTGG - Intergenic
1070864809 10:79701663-79701685 AGCTGAGAAAGAACATCTCAGGG - Intergenic
1070878599 10:79839791-79839813 AGCTGAGAAAGAACATCTCAGGG - Intergenic
1071645157 10:87356101-87356123 AGCTGAGAAAGAACATCTCAGGG - Intergenic
1072721128 10:97781659-97781681 AGCTGGAAACAGACAGCTCCAGG - Intergenic
1075214265 10:120518240-120518262 AGATGGCAAAAAGCACCGCCCGG + Intronic
1075906708 10:126087988-126088010 AGCAGGCAGAAAAGATATCCTGG - Intronic
1076093686 10:127712946-127712968 AGCCGGCAGAAGACAGCTCCTGG - Intergenic
1076831126 10:132994849-132994871 TGCTGGGAAAAAACATCCCTCGG - Intergenic
1076914061 10:133411274-133411296 AACTGGCAACAGACTTCTCCAGG - Intronic
1077573496 11:3358117-3358139 AGCTGGCAAAAAACATCTCCAGG - Intronic
1078615731 11:12863866-12863888 TGCTGCCTAAAAACATCCCCAGG - Intronic
1082559963 11:54606325-54606347 AGGTGGCAAGAAACATGCCCTGG - Intergenic
1088936357 11:114404392-114404414 AGCTGGCAAGAAAGAACACCGGG - Intronic
1089553413 11:119299717-119299739 AGATGGCCAAAAACATCCTCCGG + Exonic
1089706011 11:120278367-120278389 AGATTTCAGAAAACATCTCCCGG + Intronic
1091979483 12:4853717-4853739 AGCTGGCAAGTGACATCTGCTGG + Intergenic
1092568239 12:9692447-9692469 AGTTGACAAAAAGCATATCCTGG + Intronic
1094419568 12:30256304-30256326 AGGTGGCAAAAAATATTTACAGG + Intergenic
1094468411 12:30779285-30779307 ATATAGCAAAAAATATCTCCAGG + Intergenic
1095669467 12:44841704-44841726 GACTGGCAGTAAACATCTCCTGG + Intronic
1098894183 12:76038720-76038742 AGCTTGCCATAAACATTTCCTGG - Exonic
1099093688 12:78344570-78344592 ATCTGGCAACAGACATCTCAAGG + Intergenic
1101001922 12:100365250-100365272 AACAGACAAAAAACATCTCATGG - Intronic
1102045808 12:109829570-109829592 AGCTGGAAGAAAACATGCCCTGG + Intronic
1102826352 12:115950683-115950705 AGCTGGAAAAAGACCTCTTCTGG - Intergenic
1105008883 12:132741046-132741068 AGTTGGCAAAGAACAGCTCAGGG - Intronic
1107315976 13:39132625-39132647 AGCTGGAGACAAACTTCTCCTGG - Intergenic
1108482470 13:50888422-50888444 AGCTGACTAACAATATCTCCTGG + Intergenic
1108842746 13:54640863-54640885 AGCTGGAAAAAAATCTCTCCTGG + Intergenic
1108862751 13:54882368-54882390 AGCTGGCAAAAAACATCTCCAGG + Intergenic
1110909959 13:80946665-80946687 TGTTGGCAAAACACATCTTCTGG - Intergenic
1111330303 13:86757445-86757467 AGCTGGCAACAAACATCTCCAGG - Intergenic
1111331637 13:86765691-86765713 AGCTGGCAAAAAACATCTCCAGG - Intergenic
1111914967 13:94351257-94351279 AGCTTACAAAAAACACCACCTGG + Intronic
1112389755 13:98972219-98972241 AGCAGGCATAAAACAGTTCCTGG + Intronic
1114514466 14:23288953-23288975 ATCTGGCAAAAAACATCATGGGG + Intronic
1115798048 14:36961081-36961103 AGCTGGCAAAAACCCACACCTGG + Intronic
1116258819 14:42594973-42594995 ATCTAACAAAAAACATCTACCGG + Intergenic
1116955660 14:50920562-50920584 ACCTGGCCGAGAACATCTCCCGG - Exonic
1117520709 14:56548803-56548825 TGCTGGTAAAAACCAGCTCCTGG + Intronic
1120129996 14:80795373-80795395 AGCTAGCAAAAGAAATCTCAAGG - Intronic
1124484402 15:30102364-30102386 AACTGGAAAAAAACATCTCCAGG + Intergenic
1124519181 15:30394860-30394882 AATTGGAAAAAAACATCTCCAGG - Intergenic
1124539475 15:30571361-30571383 AACTGGAAAAAAACATCTCCAGG + Intergenic
1124759175 15:32436211-32436233 AATTGGAAAAAAACATCTCCAGG - Intergenic
1127129695 15:55849537-55849559 AGCTGGCAAAATGCATGTTCTGG - Intronic
1129209914 15:74062487-74062509 AATTGGAAAAGAACATCTCCAGG - Intergenic
1129404116 15:75302917-75302939 AATTGGAAAAGAACATCTCCAGG + Intergenic
1129477117 15:75792934-75792956 AATTGGAAAAGAACATCTCCAGG + Intergenic
1131440824 15:92458401-92458423 AGCACTCAACAAACATCTCCTGG - Intronic
1132006418 15:98231934-98231956 AGCTGGGAATGAACTTCTCCTGG + Intergenic
1132185902 15:99801441-99801463 AATTGGAAAAGAACATCTCCAGG + Intergenic
1132429776 15:101751257-101751279 AATTGGAAAAGAACATCTCCAGG - Intergenic
1134446543 16:14335576-14335598 ATCTGGCAAAAAAAGTCTCAGGG - Intergenic
1134540548 16:15061129-15061151 AGCTGGCACTGAAGATCTCCAGG - Exonic
1135026148 16:19000689-19000711 AGCTGGCAAAAAATATTGACTGG - Intronic
1135568554 16:23530575-23530597 ACCTGGCCAAAAGCTTCTCCAGG - Intronic
1135981098 16:27148057-27148079 AGCTGGCCAACAACAGCTCTGGG + Intergenic
1136998195 16:35205893-35205915 AGCAGGCAGTAGACATCTCCAGG + Intergenic
1138760741 16:59540717-59540739 CGGTGGCAAAAAACACCCCCAGG + Intergenic
1140154247 16:72405982-72406004 ACCTGGCAAAAAACAACAGCTGG + Intergenic
1141493463 16:84390504-84390526 AGCAGGCAAATAACATCTTGGGG + Intronic
1146513471 17:33470452-33470474 AGCAGGCTTAAAAAATCTCCTGG + Intronic
1149713951 17:58769112-58769134 AAATGGAAAAAAATATCTCCAGG - Intronic
1150644482 17:66969434-66969456 AGCTGGCACAAAACAGGTGCGGG - Intronic
1153082694 18:1247111-1247133 AGCTGACAAAAAACATCTCCAGG - Intergenic
1153431368 18:5021196-5021218 TTCTAGCAAAAAACATCACCAGG + Intergenic
1156126486 18:33911538-33911560 AGCAAGCAAAAAAGAACTCCTGG - Intronic
1156220714 18:35049151-35049173 ATTTGTCAAAAAACATCTCTGGG + Intronic
1158066587 18:53417729-53417751 AGTTGACAACAAACATGTCCAGG + Intronic
1158322487 18:56278898-56278920 AGCGTGTAATAAACATCTCCAGG - Intergenic
1158485305 18:57860907-57860929 AGCTGGGAGAAAAGATTTCCAGG - Intergenic
1159840097 18:73389428-73389450 AGGTGGCAAAAGTCATTTCCAGG + Intergenic
1163002086 19:14374924-14374946 AGCTGTGAAAAAATAACTCCAGG - Intergenic
1163180191 19:15593882-15593904 AGCTGGAGAAAAACAGCCCCAGG - Intergenic
1163559525 19:18010485-18010507 AGCTGGCACAAGCCAGCTCCTGG + Intronic
1164393792 19:27846729-27846751 AGCTGGCAAAAAACATCTCCAGG - Intergenic
925270599 2:2604577-2604599 GGGTGGCAAGAAACATGTCCGGG - Intergenic
925410256 2:3635655-3635677 AGCTGGCAACACACAGCGCCTGG + Intronic
925957632 2:8983412-8983434 ATCTAGAAAAAAACATCTCTAGG + Intronic
926480816 2:13391452-13391474 ATCTGGCAAAGAAAATTTCCAGG - Intergenic
928870127 2:35965998-35966020 AGCTGTCAGAAGACATCTCTTGG + Intergenic
929343997 2:40858613-40858635 AGCTTGCAAACAGCATATCCTGG - Intergenic
931001828 2:57793763-57793785 AGCTGGCAAAACACAACACACGG + Intergenic
932837789 2:75053495-75053517 AGCTAGCACAAAATATCCCCAGG - Intronic
937008602 2:118541218-118541240 AGCTGGTCAAAAACATGTGCTGG + Intergenic
938029582 2:127981230-127981252 AGCTGGCAAAAAACATCTCCAGG + Intronic
939443609 2:142280292-142280314 TGCTGGCAAAACACAACTACTGG + Intergenic
940350567 2:152681806-152681828 AGCTGTCAAAACACAGCTTCTGG + Intronic
942496242 2:176542676-176542698 TGTTGGGAAAAATCATCTCCAGG - Intergenic
942670219 2:178367335-178367357 AGCTGTCAAAAACCAAATCCTGG - Intronic
944786585 2:203076969-203076991 AGTTGGACAAAAACATTTCCTGG + Intronic
946575614 2:221072047-221072069 CAATGGGAAAAAACATCTCCAGG - Intergenic
947377356 2:229510194-229510216 AGCAGGCAAAAGACATATCCTGG + Intronic
1168942519 20:1725497-1725519 AGCAGTTAAAAAACATCCCCTGG - Intergenic
1169718493 20:8646139-8646161 TGCTGGCCCAAAACATGTCCAGG + Exonic
1173053662 20:39589804-39589826 AGCAAGCCAAAAACACCTCCTGG + Intergenic
1173772919 20:45679163-45679185 AGATGGCAGAATAGATCTCCTGG - Intergenic
1174324355 20:49767354-49767376 AGCTGGCAACCAATAGCTCCAGG - Intergenic
1178310299 21:31524544-31524566 AGATGGCAAAAAGCATTTGCTGG + Intronic
1178767228 21:35465898-35465920 AGCTGGCAAGAAGCATGTTCTGG - Intronic
1178871934 21:36384616-36384638 AGCTGGCTAAAAGCATCAGCCGG + Intronic
1178937700 21:36877801-36877823 TGATGGCAAAATACATGTCCAGG - Intronic
1183566454 22:38618943-38618965 AGCTGGAAAAAAAAATCCCAGGG - Intronic
951948336 3:28168200-28168222 AGCTGACAAATAACATTACCTGG - Intergenic
953532663 3:43752497-43752519 AGCTGGCAAGGTCCATCTCCAGG + Intergenic
955825400 3:62941052-62941074 AGGAGGGAAAAAAGATCTCCTGG - Intergenic
957164897 3:76659821-76659843 AGCTGGGAAAAACCATGGCCAGG + Intronic
957519246 3:81297259-81297281 AACTGGCAGCAAACATCTCTGGG - Intergenic
958575519 3:95945818-95945840 AGGTGGTAAAAGACATCTACAGG - Intergenic
959871805 3:111337360-111337382 AGGTGGCAAAAAACAGATCCTGG + Intronic
961057645 3:123802677-123802699 AGCAGGAAGAAAACAACTCCAGG - Intronic
961413334 3:126739436-126739458 GGTGGGCAAAAAACCTCTCCTGG + Intronic
962143773 3:132818778-132818800 AACTGGAACAAAACATTTCCGGG - Intergenic
963016232 3:140826718-140826740 AGCTAGCAAATAATATCGCCAGG + Intergenic
965655609 3:170981004-170981026 TGCAGGCAACAAAAATCTCCTGG + Intergenic
967042714 3:185708404-185708426 CACTGACCAAAAACATCTCCAGG + Intronic
968053320 3:195671617-195671639 AGCTGCCGAAAAACATCTGTGGG - Intergenic
968066174 3:195761017-195761039 AACTGCAAAAAAACAGCTCCTGG - Exonic
968102493 3:195976744-195976766 AGCTGTCGAAAAACATCTGTGGG + Intergenic
969152347 4:5180290-5180312 GGCTGGCCACTAACATCTCCTGG + Intronic
970492224 4:16585958-16585980 AGCTGTCCAAAAACATCACCAGG - Exonic
970959103 4:21852057-21852079 AGCTGACAAAAAATAACTTCTGG + Intronic
973695923 4:53491157-53491179 AGTTGGCAAACATTATCTCCAGG + Intronic
974217463 4:58869162-58869184 CGCTTTCAAAAAACATCTCCAGG + Intergenic
974304951 4:60124130-60124152 ACCTATCAAAAAACATCTGCTGG - Intergenic
974456592 4:62136712-62136734 AGCAGGCAAATAAAATCTGCAGG - Intergenic
975568556 4:75788068-75788090 AGATGGCAAAAAAAATTCCCAGG - Intronic
975709658 4:77147897-77147919 AGCTGGCAAAACACATCTTGGGG + Intergenic
976999550 4:91480711-91480733 AACATGGAAAAAACATCTCCTGG - Intronic
977838477 4:101672666-101672688 AACTGGCAAATAAAAACTCCTGG + Intronic
979761456 4:124410299-124410321 AGCTGGACACAAACACCTCCAGG - Intergenic
980109384 4:128620863-128620885 AGCTGAAAAAAAAGATCTCATGG + Intergenic
982884118 4:160756573-160756595 ACCTGCCAAAAAACGTCTGCAGG - Intergenic
983348167 4:166554199-166554221 AGTTGGCAAAGAAGACCTCCTGG - Intergenic
984055832 4:174928331-174928353 AGCTGGCAAAAAACATCTCCAGG - Intronic
985499564 5:233962-233984 AGCTGCCAAAAAACATCTGTGGG - Intronic
987994127 5:25252755-25252777 AGTTGGCAAAAAACATGAACAGG + Intergenic
989340510 5:40368859-40368881 ATCTGGCAGAAGAAATCTCCAGG - Intergenic
990018850 5:51100890-51100912 AACTGGCAAAAAACATCTCCAGG + Intergenic
994086579 5:95765960-95765982 AGCAGTCAAAAAGCATCACCGGG - Intronic
994184186 5:96800125-96800147 AGCTGGTATATAACACCTCCTGG - Intronic
994624515 5:102201340-102201362 AGCTACCCAAAAACATCTACAGG - Intergenic
996294153 5:121891199-121891221 CACTGGAATAAAACATCTCCTGG + Intergenic
996512450 5:124331936-124331958 TGCTGTCAAGAGACATCTCCAGG + Intergenic
997127639 5:131244408-131244430 AGCACACAAAAAACATCTTCAGG + Intergenic
1001559688 5:172660929-172660951 GGCTGGAAAAAAACATAACCAGG - Intronic
1002803159 6:546203-546225 GACTGGAAAAAGACATCTCCAGG + Intronic
1002950317 6:1803316-1803338 AGAAGGCAAAAAACGTCTCTGGG + Intronic
1004023028 6:11791451-11791473 ATCTGGCAAAAAACATCTCCAGG + Intronic
1008461840 6:51784346-51784368 AGCTGACAAAAAACAGGACCAGG - Intronic
1010009588 6:71035218-71035240 AGTCTGCAGAAAACATCTCCTGG + Intergenic
1011045085 6:83072928-83072950 AGCAGGAGAAAAACCTCTCCAGG - Intronic
1014240151 6:119008392-119008414 AGCTGGCAAAAAACCTTTTCTGG - Intronic
1014458361 6:121665178-121665200 AAATGGCAAAAAAAATCTCATGG - Intergenic
1017054684 6:150426099-150426121 GGCTGGCAAACTACATCCCCTGG + Intergenic
1017611117 6:156187391-156187413 AGCAGGAAAAAAAAATCTCTAGG + Intergenic
1018404771 6:163467675-163467697 AAGTGGCTAAATACATCTCCTGG - Intronic
1023162906 7:37314669-37314691 AGCTGGCAAATATCATCTTGTGG + Intronic
1030031094 7:105370242-105370264 AGCTAGGAATAAACATCCCCAGG - Intronic
1031097367 7:117436599-117436621 GGCTGGCTAAAATTATCTCCAGG - Intergenic
1036758390 8:11487759-11487781 AGCTTACATAAAACATCACCAGG - Intergenic
1037072774 8:14673032-14673054 AGCTGGCAAACAACAGCCTCAGG - Intronic
1037086368 8:14855801-14855823 TGCTGGCAAAAACCATCACTAGG - Intronic
1037505424 8:19524769-19524791 AGCTGGAAATAAACATCTTGGGG - Intronic
1038439350 8:27560664-27560686 AACTTGCAACAAACAACTCCAGG + Intergenic
1039089289 8:33811230-33811252 AGATTGCAAAATGCATCTCCAGG + Intergenic
1039776712 8:40744352-40744374 AGGTGGCAAGACACATCTGCAGG + Intronic
1040096463 8:43448822-43448844 ATCTGACAAAAAACACTTCCTGG - Intergenic
1040594914 8:48828038-48828060 AGCTGTCTAAAAACCTGTCCTGG + Intergenic
1043909616 8:85846558-85846580 AGATGGCAAAAACCATAACCTGG - Intergenic
1044740848 8:95324623-95324645 ACCTGGCAGACACCATCTCCAGG - Intergenic
1049428163 8:142546648-142546670 AGCTGGCCAAAAACTTGTTCTGG - Intergenic
1050791660 9:9478908-9478930 AGTTGCCAAAAAATTTCTCCCGG - Intronic
1055365733 9:75542731-75542753 GGATGGCAAAAAACATTTTCGGG + Intergenic
1055588368 9:77782191-77782213 AGCTTAAAAAAAAAATCTCCTGG + Intronic
1056762724 9:89426457-89426479 GGCTGGCAAAAGCCATGTCCTGG - Intronic
1058131177 9:101255330-101255352 AGATGGCACAACACAGCTCCAGG + Intronic
1062271184 9:135709974-135709996 ATCTGGCAGAAAACATGGCCGGG - Intronic
1062729238 9:138099917-138099939 ATCTGTCTAATAACATCTCCTGG + Intronic
1185551411 X:985171-985193 AGCTGGCAAAAGACATCTCCAGG + Intergenic
1185699397 X:2219042-2219064 AGCTGGTGAAAAACATCTCCAGG + Intergenic
1186373173 X:8967585-8967607 AGAAGGCAACAAACACCTCCTGG - Intergenic
1186488124 X:9949862-9949884 TTCTGGCAAAGCACATCTCCTGG + Intergenic
1187365644 X:18663869-18663891 AGCTAGCAAGAGACATCTACGGG - Intronic
1188125525 X:26363711-26363733 AACTGGCAAAAAAAATCTCCTGG + Intergenic
1192931162 X:75807737-75807759 ATCTTTCAAAAAACAGCTCCTGG + Intergenic
1196506475 X:116450323-116450345 AACTGGCAAAAGACATGACCAGG + Intronic
1197842829 X:130768325-130768347 AGCTAACAAAAAACATTTACAGG - Intronic
1199395338 X:147330696-147330718 AGCTGGCAAAAAACATCTCCAGG + Intergenic
1200130204 X:153838340-153838362 AACGGGCAAAAGACAACTCCAGG - Intergenic
1201221909 Y:11779924-11779946 AGGTAGCAAAAAACAATTCCAGG - Intergenic
1201273969 Y:12281827-12281849 AGCTGGCAAAAAACTTCTGCAGG - Intergenic
1201274953 Y:12287933-12287955 AGCCGGCAAGAAACATCTCCAGG - Intergenic