ID: 984055834

View in Genome Browser
Species Human (GRCh38)
Location 4:174928348-174928370
Sequence TTCACCTTGCATAACAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 2, 1: 4, 2: 10, 3: 15, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984055834_984055835 10 Left 984055834 4:174928348-174928370 CCAGCTTTGTTATGCAAGGTGAA 0: 2
1: 4
2: 10
3: 15
4: 113
Right 984055835 4:174928381-174928403 AACCGCATCCTGTAACTGACTGG No data
984055834_984055838 21 Left 984055834 4:174928348-174928370 CCAGCTTTGTTATGCAAGGTGAA 0: 2
1: 4
2: 10
3: 15
4: 113
Right 984055838 4:174928392-174928414 GTAACTGACTGGTTAGTTACTGG 0: 1
1: 0
2: 1
3: 4
4: 68
984055834_984055840 25 Left 984055834 4:174928348-174928370 CCAGCTTTGTTATGCAAGGTGAA 0: 2
1: 4
2: 10
3: 15
4: 113
Right 984055840 4:174928396-174928418 CTGACTGGTTAGTTACTGGAGGG 0: 1
1: 0
2: 1
3: 5
4: 116
984055834_984055841 26 Left 984055834 4:174928348-174928370 CCAGCTTTGTTATGCAAGGTGAA 0: 2
1: 4
2: 10
3: 15
4: 113
Right 984055841 4:174928397-174928419 TGACTGGTTAGTTACTGGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 112
984055834_984055839 24 Left 984055834 4:174928348-174928370 CCAGCTTTGTTATGCAAGGTGAA 0: 2
1: 4
2: 10
3: 15
4: 113
Right 984055839 4:174928395-174928417 ACTGACTGGTTAGTTACTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984055834 Original CRISPR TTCACCTTGCATAACAAAGC TGG (reversed) Intronic
900615579 1:3564285-3564307 TTCACCTCGCATAACAAAGCTGG - Intronic
903117770 1:21192251-21192273 TTCACCTTGAATACAAGAGCTGG - Intergenic
904710115 1:32423886-32423908 CTAACCTTGCTTAACAAAGCTGG - Intergenic
910626330 1:89311965-89311987 TTCACCTTGCATAACAAAGCTGG - Intergenic
912152529 1:106878129-106878151 TTCACCTCACATAACAAAGCTGG + Intergenic
912764754 1:112398304-112398326 TTCACCTAGCATGACCAAACAGG - Intronic
913408132 1:118518693-118518715 TTCAACATAAATAACAAAGCTGG - Intergenic
915702864 1:157812363-157812385 TACACCTGGCATCACAGAGCAGG + Intronic
916810464 1:168301205-168301227 TGCACCTTCCATAACAGACCTGG + Intronic
919100497 1:193091317-193091339 TTCACTTTGCCTTTCAAAGCAGG + Intronic
921432866 1:215083232-215083254 CCCACCTTGTAAAACAAAGCCGG + Exonic
923195683 1:231664426-231664448 TTTACCTTGCATGACAAAAAGGG + Intronic
923648933 1:235853728-235853750 GGCTCCTTGCAGAACAAAGCTGG + Intronic
1065660570 10:28000647-28000669 TTCACCTTGGTTTGCAAAGCTGG + Intergenic
1066328282 10:34388867-34388889 TTGTCCTAGCATAACAAATCTGG - Intronic
1067957801 10:50812204-50812226 CTCACCTGGCATAAACAAGCAGG - Intronic
1069128756 10:64672210-64672232 TTCAACCTGCGTGACAAAGCAGG - Intergenic
1072006369 10:91253412-91253434 TTCAGCTTGGGAAACAAAGCAGG - Intronic
1074475384 10:113769175-113769197 TGCACCTTGAATAACAATGATGG - Intronic
1075962139 10:126577698-126577720 GTAATCTTGAATAACAAAGCTGG + Intronic
1077572514 11:3352428-3352450 TTCACCTCGCATAACAAAGCTGG - Intronic
1077573498 11:3358134-3358156 TTCACCTCGCATAACAAAGCTGG - Intronic
1078012155 11:7580681-7580703 TTTACCTTGGATCACACAGCTGG - Intronic
1085367311 11:75961739-75961761 TTCATCTAGCAGAATAAAGCAGG - Intronic
1090060180 11:123457910-123457932 ACCACCTTGGATAACATAGCAGG - Intergenic
1090707364 11:129350811-129350833 TTCACCTTCCATAATCAAGTGGG + Intergenic
1094043894 12:26146142-26146164 TTCACCCTGCATAGCAAAGTGGG + Intronic
1094372819 12:29756653-29756675 TTCACCTTGTAAAACAGAGCGGG + Intronic
1095585124 12:43841185-43841207 TTCAACTAGCAGAACAAAACAGG - Intronic
1097162930 12:57062093-57062115 GTCACCTTGCATAATAAATATGG - Intronic
1097802052 12:63925215-63925237 TTCACCTTGAATATGAATGCTGG - Intronic
1102313777 12:111868975-111868997 TTCTGATTACATAACAAAGCAGG - Intronic
1104145661 12:126031381-126031403 TTGACCTTGCATCACCAGGCAGG - Intergenic
1106612692 13:31298831-31298853 TTCACCCCGCTTAGCAAAGCTGG - Intronic
1108862749 13:54882351-54882373 TTCACCTGGCATAACAAAGCTGG + Intergenic
1109651901 13:65337914-65337936 GTCACCTTGTATAATAAATCTGG - Intergenic
1111249913 13:85589362-85589384 CTCACCTCACATAACAAAGCTGG - Intergenic
1111330306 13:86757462-86757484 CCCACCTTGCATAACAAAGCTGG - Intergenic
1111331640 13:86765708-86765730 CCCACCTTGCATAACGAAGCTGG - Intergenic
1115312396 14:31992674-31992696 TCCACCTTGCATAAAAGATCTGG - Intergenic
1117083130 14:52172081-52172103 TTCACTTTGCAAAACAAAGAAGG + Intergenic
1140239406 16:73187819-73187841 CCCACGTTGCATAACAGAGCTGG + Intergenic
1142471903 17:169385-169407 TTCAGCTTGCAAAACTAAACTGG - Intronic
1143802156 17:9392243-9392265 TTCAAGTTGCATAAGAAACCTGG + Intronic
1150249787 17:63699338-63699360 TTCCCCTTGCAGAACCCAGCGGG - Exonic
1152036691 17:77877841-77877863 CTCACCTTGCGTCACCAAGCTGG + Intergenic
1156137351 18:34058462-34058484 CTCACCTAGCAGGACAAAGCAGG - Intronic
1159843551 18:73429262-73429284 TTAACATTGAATAACAAAGCTGG + Intergenic
1160888995 19:1367025-1367047 GTCACCTTCCATAAATAAGCTGG + Intronic
1163851743 19:19668366-19668388 CCCACCTTGCATAACAAAGCTGG - Intergenic
1164393794 19:27846746-27846768 TTAACCTCGCATAACAAAGCTGG - Intergenic
1165819760 19:38666887-38666909 TTGACCTTCCAAAACAAAGTGGG - Intronic
1167281778 19:48573439-48573461 TCCACCTTGTAAAACAAATCTGG - Intronic
927591088 2:24358893-24358915 TTTACCTTTCATTACAAAGGTGG + Intronic
928391074 2:30911525-30911547 TTGACCTCGCATGACAAAGGAGG + Intronic
929903962 2:46029963-46029985 TTCACCTTGCGTCACAGAGAGGG - Intronic
931366069 2:61620083-61620105 TTCACCTTGAATAACAATCCAGG - Intergenic
932259477 2:70315047-70315069 TTCAGCTTGGACAACACAGCCGG + Intergenic
933861631 2:86475207-86475229 TTCACCTTTCCTAACAAAAAAGG - Intronic
938029580 2:127981213-127981235 TTCACCTCGCACAACAAAGCTGG + Intronic
939913684 2:148014223-148014245 AGCACATTGCCTAACAAAGCTGG + Intronic
940436020 2:153656022-153656044 CACAGTTTGCATAACAAAGCGGG - Intergenic
943300907 2:186198418-186198440 ATCACCGTGCATAAGGAAGCAGG + Intergenic
944344183 2:198640569-198640591 TTCACCTTGTATATCACACCAGG - Intergenic
945590676 2:211726392-211726414 TACACCTTGCATATCAAAATGGG - Intronic
947852683 2:233301022-233301044 TCCACCTTGCAAGACAAGGCAGG + Intergenic
1170074783 20:12407678-12407700 TTCATCCTGCATAGCAAAACTGG - Intergenic
1173402317 20:42736588-42736610 GTCACCTTGGATAACAAGGGTGG + Intronic
1173537132 20:43824129-43824151 CTCACATTGCATAACATTGCAGG + Intergenic
1174912728 20:54624152-54624174 TGCACTTTGCTTTACAAAGCAGG - Intronic
1175430285 20:58896954-58896976 TTCACCTTTCAGAGCAAGGCAGG + Intronic
1178188643 21:30254880-30254902 TTCTTCTTGCATACCAAAACTGG - Intergenic
1179064600 21:38012900-38012922 TGCAGCTTGCATAATGAAGCAGG - Intronic
1183572776 22:38666568-38666590 GTCACCTTCCATAACAGAACAGG + Intronic
949601870 3:5608544-5608566 GTCACATTGGATAAAAAAGCAGG + Intergenic
951337403 3:21441507-21441529 TTCAGCATGCATAATAAATCAGG - Intronic
953329460 3:42040462-42040484 TTCACCTCACAGAACAAAGTTGG - Intronic
954075373 3:48174806-48174828 TGCACCTTGCTTAATTAAGCAGG + Intronic
955018496 3:55095427-55095449 TTTAACTTGAAAAACAAAGCTGG + Intergenic
955704428 3:61713511-61713533 ATCCCCTTGCCTAACAAAGGAGG - Intronic
957186800 3:76951953-76951975 TACATCTTGCAAGACAAAGCTGG - Intronic
958891143 3:99784142-99784164 TGTACCTTGTAAAACAAAGCTGG + Intronic
959684271 3:109127940-109127962 TACACATGGCATATCAAAGCCGG - Intergenic
966760463 3:183413560-183413582 CTCACCTCGCATAACAAAGCTGG + Intronic
966967825 3:185013295-185013317 ATCACTTTGCAAAACAAAGAAGG - Intronic
968766193 4:2470826-2470848 TTCACCTTGCAAAAAAAAAAAGG - Intronic
970528605 4:16958706-16958728 TTTACCTTGCAACACAAAGATGG + Intergenic
971580559 4:28334174-28334196 TTCTCCTGGCACAACAAAACAGG - Intergenic
971966418 4:33562858-33562880 TTCATCTTGCAAAACAGAGGTGG - Intergenic
972918696 4:43910501-43910523 CCTACCTTGCATAACAAAGCTGG + Intergenic
975225168 4:71863507-71863529 ATCACTTTGCAAAACAAAGAAGG + Intergenic
976130930 4:81883286-81883308 TTCAGCTTTAATAACAAAGATGG + Intronic
976186220 4:82445484-82445506 TCCACCCTGGGTAACAAAGCGGG - Intronic
976288610 4:83394550-83394572 TTCACCTTTCATACCTAACCTGG - Intergenic
977161957 4:93645886-93645908 TTCATCTTCCATAATAAAGTAGG + Intronic
977443259 4:97097400-97097422 ATCACTTTGCAAAACAAAGAAGG - Intergenic
982019268 4:151187201-151187223 TTTCTCTTGCAGAACAAAGCTGG - Intronic
983374553 4:166908758-166908780 TACACTTTACATAACAAAGTGGG + Intronic
983509990 4:168598691-168598713 TACAGCTTGCAAAACAAAGGTGG - Intronic
984055834 4:174928348-174928370 TTCACCTTGCATAACAAAGCTGG - Intronic
985047796 4:185957864-185957886 TTCACCCTGCAGAACACAGAAGG + Intergenic
986314623 5:6578263-6578285 TTCACCCTGAGTCACAAAGCTGG - Intergenic
989030640 5:37115016-37115038 TTCACCATACAGAAAAAAGCTGG - Exonic
990018849 5:51100873-51100895 TTCACTTCGCATAACAAAACTGG + Intergenic
990060855 5:51646579-51646601 TTCAGGTTGCATTTCAAAGCTGG + Intergenic
991904919 5:71499985-71500007 TTCACAATGCATAACAATTCAGG - Intronic
993426227 5:87767650-87767672 TTCATATTGTATAACAAAACTGG - Intergenic
994426094 5:99588959-99588981 TTAACCTGGAATAACAAAGATGG - Intergenic
997548492 5:134731677-134731699 TTCTCCTTTAATAACAAAGTTGG - Intergenic
998038179 5:138933931-138933953 TTCATCTTCCATGACACAGCAGG - Exonic
1000833182 5:166128263-166128285 CCCACCTTGCATAACTGAGCAGG - Intergenic
1002620538 5:180485012-180485034 CTGACCTTGAATAACAAACCCGG - Intergenic
1003561538 6:7184736-7184758 TTCACCTTGCAATAGACAGCAGG - Intronic
1004023026 6:11791434-11791456 TTCACCTTGCGTAACAAATCTGG + Intronic
1004619258 6:17319131-17319153 TCTACCTTGCATAACAGAACTGG - Intergenic
1004620608 6:17327219-17327241 TCTACCTTGCATAACAGAACTGG - Intergenic
1005570076 6:27136447-27136469 TTCACATTACAAAACAAATCTGG - Intergenic
1009443808 6:63715507-63715529 TTCATCTTGCAAAAGAAATCTGG - Intronic
1009893466 6:69718010-69718032 TTCTACTTTCATAAGAAAGCCGG + Intronic
1013154928 6:107484181-107484203 TTCACTTTGCATGGCAAAGGGGG + Intergenic
1014366973 6:120556104-120556126 TGCACCTGGCATAAGAAAGCTGG + Intergenic
1021896669 7:25243020-25243042 TTTACCTTTCATTAAAAAGCTGG + Intergenic
1025875281 7:65475951-65475973 TTGACCTCGCATAACAAAGCTGG + Intergenic
1029964643 7:104726482-104726504 TTCACCCTGCCTAACCCAGCAGG + Intronic
1032908151 7:136396512-136396534 TTCAGATTGCATAAAAAAGCAGG + Intergenic
1033996612 7:147357550-147357572 ATCACCTTGAATAGCAAAACTGG - Intronic
1034580607 7:152038619-152038641 ATCACTTTGCAAAACAAAGGGGG - Intronic
1036524710 8:9524270-9524292 CTAACCTTGAAGAACAAAGCTGG + Intergenic
1038390551 8:27195674-27195696 GTCAGATTGCATAAAAAAGCAGG - Intergenic
1041019422 8:53623560-53623582 ATCACTTTGCAAAACAAAGAAGG + Intergenic
1043133736 8:76494375-76494397 TTCAGCATGCATAACCAAGTGGG - Intergenic
1046333297 8:112750409-112750431 TTCTCCTGGCATATGAAAGCAGG - Intronic
1047033735 8:120912537-120912559 CTCACCTTGGATAAGAAAGAAGG + Intergenic
1050604295 9:7284638-7284660 TGCAGCTTGCATAACAAAGAGGG - Intergenic
1050654450 9:7811080-7811102 CTCACCCTACATATCAAAGCAGG - Intronic
1058218461 9:102264273-102264295 TTCACCTTTCAAAAAATAGCCGG - Intergenic
1185699395 X:2219025-2219047 TGAACCTTGCATAACAAAGCTGG + Intergenic
1187029013 X:15466531-15466553 TTCACCCTGCATACCAAACCTGG - Intronic
1188643313 X:32534061-32534083 TACTCATTGCTTAACAAAGCCGG + Intronic
1191149295 X:57203531-57203553 ATCACTTTGCAAAACAAAGGGGG - Intergenic
1199395336 X:147330679-147330701 CTAACCTCACATAACAAAGCTGG + Intergenic
1200720048 Y:6595344-6595366 TTCCCCTGGCTTAACACAGCTGG - Intergenic
1201273971 Y:12281844-12281866 TTAACCTCGCATAACACAGCTGG - Intergenic
1201274955 Y:12287950-12287972 TTAACCTCGCATAACAAAGCCGG - Intergenic