ID: 984055835

View in Genome Browser
Species Human (GRCh38)
Location 4:174928381-174928403
Sequence AACCGCATCCTGTAACTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984055832_984055835 27 Left 984055832 4:174928331-174928353 CCTGGAGATGTTTTTTGCCAGCT 0: 8
1: 6
2: 6
3: 11
4: 195
Right 984055835 4:174928381-174928403 AACCGCATCCTGTAACTGACTGG No data
984055834_984055835 10 Left 984055834 4:174928348-174928370 CCAGCTTTGTTATGCAAGGTGAA 0: 2
1: 4
2: 10
3: 15
4: 113
Right 984055835 4:174928381-174928403 AACCGCATCCTGTAACTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984055835 Original CRISPR AACCGCATCCTGTAACTGAC TGG Intronic
No off target data available for this crispr