ID: 984060283

View in Genome Browser
Species Human (GRCh38)
Location 4:174982016-174982038
Sequence GACAGCTCTTGGCCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984060283_984060287 15 Left 984060283 4:174982016-174982038 CCAGTAGCAGGCCAAGAGCTGTC No data
Right 984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225
984060283_984060288 16 Left 984060283 4:174982016-174982038 CCAGTAGCAGGCCAAGAGCTGTC No data
Right 984060288 4:174982055-174982077 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
984060283_984060286 11 Left 984060283 4:174982016-174982038 CCAGTAGCAGGCCAAGAGCTGTC No data
Right 984060286 4:174982050-174982072 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984060283 Original CRISPR GACAGCTCTTGGCCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr