ID: 984065917

View in Genome Browser
Species Human (GRCh38)
Location 4:175047983-175048005
Sequence GGCTCACGGTTCCACATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984065917_984065924 13 Left 984065917 4:175047983-175048005 CCAGTCATGTGGAACCGTGAGCC No data
Right 984065924 4:175048019-175048041 TTTCTTTGGAAATTAGTCTCGGG No data
984065917_984065923 12 Left 984065917 4:175047983-175048005 CCAGTCATGTGGAACCGTGAGCC No data
Right 984065923 4:175048018-175048040 TTTTCTTTGGAAATTAGTCTCGG No data
984065917_984065921 -1 Left 984065917 4:175047983-175048005 CCAGTCATGTGGAACCGTGAGCC No data
Right 984065921 4:175048005-175048027 CCGTTAAACCTCTTTTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984065917 Original CRISPR GGCTCACGGTTCCACATGAC TGG (reversed) Intergenic
No off target data available for this crispr