ID: 984073088

View in Genome Browser
Species Human (GRCh38)
Location 4:175140706-175140728
Sequence CAGTCTGAGCTGTTGGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984073088_984073096 21 Left 984073088 4:175140706-175140728 CCTGATTCCAACAGCTCAGACTG No data
Right 984073096 4:175140750-175140772 GGGTGATTCTGGAGGTTGAAGGG No data
984073088_984073091 0 Left 984073088 4:175140706-175140728 CCTGATTCCAACAGCTCAGACTG No data
Right 984073091 4:175140729-175140751 TCATTACAATCTAGGAGCTTTGG No data
984073088_984073094 13 Left 984073088 4:175140706-175140728 CCTGATTCCAACAGCTCAGACTG No data
Right 984073094 4:175140742-175140764 GGAGCTTTGGGTGATTCTGGAGG No data
984073088_984073097 24 Left 984073088 4:175140706-175140728 CCTGATTCCAACAGCTCAGACTG No data
Right 984073097 4:175140753-175140775 TGATTCTGGAGGTTGAAGGGAGG No data
984073088_984073095 20 Left 984073088 4:175140706-175140728 CCTGATTCCAACAGCTCAGACTG No data
Right 984073095 4:175140749-175140771 TGGGTGATTCTGGAGGTTGAAGG No data
984073088_984073092 1 Left 984073088 4:175140706-175140728 CCTGATTCCAACAGCTCAGACTG No data
Right 984073092 4:175140730-175140752 CATTACAATCTAGGAGCTTTGGG No data
984073088_984073098 28 Left 984073088 4:175140706-175140728 CCTGATTCCAACAGCTCAGACTG No data
Right 984073098 4:175140757-175140779 TCTGGAGGTTGAAGGGAGGAAGG No data
984073088_984073090 -8 Left 984073088 4:175140706-175140728 CCTGATTCCAACAGCTCAGACTG No data
Right 984073090 4:175140721-175140743 TCAGACTGTCATTACAATCTAGG No data
984073088_984073093 10 Left 984073088 4:175140706-175140728 CCTGATTCCAACAGCTCAGACTG No data
Right 984073093 4:175140739-175140761 CTAGGAGCTTTGGGTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984073088 Original CRISPR CAGTCTGAGCTGTTGGAATC AGG (reversed) Intergenic
No off target data available for this crispr