ID: 984077111

View in Genome Browser
Species Human (GRCh38)
Location 4:175196981-175197003
Sequence CTGTATTTTCAGTCAAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984077111_984077120 28 Left 984077111 4:175196981-175197003 CCCCGTCTTGACTGAAAATACAG No data
Right 984077120 4:175197032-175197054 TGTAATCCCAGCTACTCGGGAGG 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506
984077111_984077116 -6 Left 984077111 4:175196981-175197003 CCCCGTCTTGACTGAAAATACAG No data
Right 984077116 4:175196998-175197020 ATACAGCAATTAGCTGGGCATGG No data
984077111_984077119 25 Left 984077111 4:175196981-175197003 CCCCGTCTTGACTGAAAATACAG No data
Right 984077119 4:175197029-175197051 ATCTGTAATCCCAGCTACTCGGG 0: 2101
1: 38336
2: 160760
3: 257844
4: 211149
984077111_984077117 -3 Left 984077111 4:175196981-175197003 CCCCGTCTTGACTGAAAATACAG No data
Right 984077117 4:175197001-175197023 CAGCAATTAGCTGGGCATGGTGG No data
984077111_984077118 24 Left 984077111 4:175196981-175197003 CCCCGTCTTGACTGAAAATACAG No data
Right 984077118 4:175197028-175197050 TATCTGTAATCCCAGCTACTCGG 0: 155
1: 7302
2: 95462
3: 165452
4: 182083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984077111 Original CRISPR CTGTATTTTCAGTCAAGACG GGG (reversed) Intergenic
No off target data available for this crispr