ID: 984077117

View in Genome Browser
Species Human (GRCh38)
Location 4:175197001-175197023
Sequence CAGCAATTAGCTGGGCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984077112_984077117 -4 Left 984077112 4:175196982-175197004 CCCGTCTTGACTGAAAATACAGC No data
Right 984077117 4:175197001-175197023 CAGCAATTAGCTGGGCATGGTGG No data
984077109_984077117 16 Left 984077109 4:175196962-175196984 CCTGGCCAACTTGGTGAAACCCC 0: 488
1: 69646
2: 156958
3: 199089
4: 158897
Right 984077117 4:175197001-175197023 CAGCAATTAGCTGGGCATGGTGG No data
984077110_984077117 11 Left 984077110 4:175196967-175196989 CCAACTTGGTGAAACCCCGTCTT 0: 9
1: 1291
2: 42323
3: 137913
4: 146690
Right 984077117 4:175197001-175197023 CAGCAATTAGCTGGGCATGGTGG No data
984077111_984077117 -3 Left 984077111 4:175196981-175197003 CCCCGTCTTGACTGAAAATACAG No data
Right 984077117 4:175197001-175197023 CAGCAATTAGCTGGGCATGGTGG No data
984077113_984077117 -5 Left 984077113 4:175196983-175197005 CCGTCTTGACTGAAAATACAGCA No data
Right 984077117 4:175197001-175197023 CAGCAATTAGCTGGGCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984077117 Original CRISPR CAGCAATTAGCTGGGCATGG TGG Intergenic
No off target data available for this crispr