ID: 984077118

View in Genome Browser
Species Human (GRCh38)
Location 4:175197028-175197050
Sequence TATCTGTAATCCCAGCTACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 450454
Summary {0: 155, 1: 7302, 2: 95462, 3: 165452, 4: 182083}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984077112_984077118 23 Left 984077112 4:175196982-175197004 CCCGTCTTGACTGAAAATACAGC No data
Right 984077118 4:175197028-175197050 TATCTGTAATCCCAGCTACTCGG 0: 155
1: 7302
2: 95462
3: 165452
4: 182083
984077111_984077118 24 Left 984077111 4:175196981-175197003 CCCCGTCTTGACTGAAAATACAG No data
Right 984077118 4:175197028-175197050 TATCTGTAATCCCAGCTACTCGG 0: 155
1: 7302
2: 95462
3: 165452
4: 182083
984077113_984077118 22 Left 984077113 4:175196983-175197005 CCGTCTTGACTGAAAATACAGCA No data
Right 984077118 4:175197028-175197050 TATCTGTAATCCCAGCTACTCGG 0: 155
1: 7302
2: 95462
3: 165452
4: 182083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984077118 Original CRISPR TATCTGTAATCCCAGCTACT CGG Intergenic
Too many off-targets to display for this crispr