ID: 984077119

View in Genome Browser
Species Human (GRCh38)
Location 4:175197029-175197051
Sequence ATCTGTAATCCCAGCTACTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 670190
Summary {0: 2101, 1: 38336, 2: 160760, 3: 257844, 4: 211149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984077111_984077119 25 Left 984077111 4:175196981-175197003 CCCCGTCTTGACTGAAAATACAG No data
Right 984077119 4:175197029-175197051 ATCTGTAATCCCAGCTACTCGGG 0: 2101
1: 38336
2: 160760
3: 257844
4: 211149
984077113_984077119 23 Left 984077113 4:175196983-175197005 CCGTCTTGACTGAAAATACAGCA No data
Right 984077119 4:175197029-175197051 ATCTGTAATCCCAGCTACTCGGG 0: 2101
1: 38336
2: 160760
3: 257844
4: 211149
984077112_984077119 24 Left 984077112 4:175196982-175197004 CCCGTCTTGACTGAAAATACAGC No data
Right 984077119 4:175197029-175197051 ATCTGTAATCCCAGCTACTCGGG 0: 2101
1: 38336
2: 160760
3: 257844
4: 211149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984077119 Original CRISPR ATCTGTAATCCCAGCTACTC GGG Intergenic
Too many off-targets to display for this crispr