ID: 984077120

View in Genome Browser
Species Human (GRCh38)
Location 4:175197032-175197054
Sequence TGTAATCCCAGCTACTCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1116664
Summary {0: 44593, 1: 206846, 2: 252437, 3: 185282, 4: 427506}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984077112_984077120 27 Left 984077112 4:175196982-175197004 CCCGTCTTGACTGAAAATACAGC No data
Right 984077120 4:175197032-175197054 TGTAATCCCAGCTACTCGGGAGG 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506
984077113_984077120 26 Left 984077113 4:175196983-175197005 CCGTCTTGACTGAAAATACAGCA No data
Right 984077120 4:175197032-175197054 TGTAATCCCAGCTACTCGGGAGG 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506
984077111_984077120 28 Left 984077111 4:175196981-175197003 CCCCGTCTTGACTGAAAATACAG No data
Right 984077120 4:175197032-175197054 TGTAATCCCAGCTACTCGGGAGG 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984077120 Original CRISPR TGTAATCCCAGCTACTCGGG AGG Intergenic
Too many off-targets to display for this crispr