ID: 984081420

View in Genome Browser
Species Human (GRCh38)
Location 4:175253493-175253515
Sequence AATTAAGCACAGTGGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984081408_984081420 16 Left 984081408 4:175253454-175253476 CCCACCGTACCAATGGAACCTTT No data
Right 984081420 4:175253493-175253515 AATTAAGCACAGTGGGAACCAGG No data
984081414_984081420 -2 Left 984081414 4:175253472-175253494 CCTTTCTTGCCCTGGCCAAGGAA No data
Right 984081420 4:175253493-175253515 AATTAAGCACAGTGGGAACCAGG No data
984081409_984081420 15 Left 984081409 4:175253455-175253477 CCACCGTACCAATGGAACCTTTC No data
Right 984081420 4:175253493-175253515 AATTAAGCACAGTGGGAACCAGG No data
984081411_984081420 7 Left 984081411 4:175253463-175253485 CCAATGGAACCTTTCTTGCCCTG No data
Right 984081420 4:175253493-175253515 AATTAAGCACAGTGGGAACCAGG No data
984081410_984081420 12 Left 984081410 4:175253458-175253480 CCGTACCAATGGAACCTTTCTTG No data
Right 984081420 4:175253493-175253515 AATTAAGCACAGTGGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984081420 Original CRISPR AATTAAGCACAGTGGGAACC AGG Intergenic
No off target data available for this crispr