ID: 984088587

View in Genome Browser
Species Human (GRCh38)
Location 4:175342470-175342492
Sequence ATGAAGATATTAAACCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984088586_984088587 -1 Left 984088586 4:175342448-175342470 CCATAGATGGCTAATTGGGTTAA No data
Right 984088587 4:175342470-175342492 ATGAAGATATTAAACCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984088587 Original CRISPR ATGAAGATATTAAACCCTGA AGG Intergenic
No off target data available for this crispr