ID: 984092118

View in Genome Browser
Species Human (GRCh38)
Location 4:175387474-175387496
Sequence CCTGTGAGGAAGGATGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984092118_984092129 -5 Left 984092118 4:175387474-175387496 CCTGACCCATCCTTCCTCACAGG No data
Right 984092129 4:175387492-175387514 ACAGGGTGGGGGATCCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984092118 Original CRISPR CCTGTGAGGAAGGATGGGTC AGG (reversed) Intergenic
No off target data available for this crispr