ID: 984093049

View in Genome Browser
Species Human (GRCh38)
Location 4:175398754-175398776
Sequence AGATTTTGTTATTTTGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984093049_984093051 29 Left 984093049 4:175398754-175398776 CCTTGAACAAAATAACAAAATCT No data
Right 984093051 4:175398806-175398828 AACTAAGTGTGATTAATCTCTGG No data
984093049_984093052 30 Left 984093049 4:175398754-175398776 CCTTGAACAAAATAACAAAATCT No data
Right 984093052 4:175398807-175398829 ACTAAGTGTGATTAATCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984093049 Original CRISPR AGATTTTGTTATTTTGTTCA AGG (reversed) Intergenic
No off target data available for this crispr