ID: 984093051

View in Genome Browser
Species Human (GRCh38)
Location 4:175398806-175398828
Sequence AACTAAGTGTGATTAATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984093049_984093051 29 Left 984093049 4:175398754-175398776 CCTTGAACAAAATAACAAAATCT No data
Right 984093051 4:175398806-175398828 AACTAAGTGTGATTAATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984093051 Original CRISPR AACTAAGTGTGATTAATCTC TGG Intergenic
No off target data available for this crispr