ID: 984096406

View in Genome Browser
Species Human (GRCh38)
Location 4:175440496-175440518
Sequence ATTGCCCAGTTGAATGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984096404_984096406 5 Left 984096404 4:175440468-175440490 CCAGAAAACCAGTCATAAAGCTA No data
Right 984096406 4:175440496-175440518 ATTGCCCAGTTGAATGATGATGG No data
984096405_984096406 -3 Left 984096405 4:175440476-175440498 CCAGTCATAAAGCTATTGTCATT No data
Right 984096406 4:175440496-175440518 ATTGCCCAGTTGAATGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984096406 Original CRISPR ATTGCCCAGTTGAATGATGA TGG Intergenic
No off target data available for this crispr