ID: 984096406 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:175440496-175440518 |
Sequence | ATTGCCCAGTTGAATGATGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
984096404_984096406 | 5 | Left | 984096404 | 4:175440468-175440490 | CCAGAAAACCAGTCATAAAGCTA | No data | ||
Right | 984096406 | 4:175440496-175440518 | ATTGCCCAGTTGAATGATGATGG | No data | ||||
984096405_984096406 | -3 | Left | 984096405 | 4:175440476-175440498 | CCAGTCATAAAGCTATTGTCATT | No data | ||
Right | 984096406 | 4:175440496-175440518 | ATTGCCCAGTTGAATGATGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
984096406 | Original CRISPR | ATTGCCCAGTTGAATGATGA TGG | Intergenic | ||
No off target data available for this crispr |