ID: 984101030

View in Genome Browser
Species Human (GRCh38)
Location 4:175485841-175485863
Sequence GAATATGTTGATTCACTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984101030_984101031 2 Left 984101030 4:175485841-175485863 CCATTAAGTGAATCAACATATTC No data
Right 984101031 4:175485866-175485888 AAAGTACTAAAAGCAAAGAAAGG No data
984101030_984101035 12 Left 984101030 4:175485841-175485863 CCATTAAGTGAATCAACATATTC No data
Right 984101035 4:175485876-175485898 AAGCAAAGAAAGGGGAAAGGAGG No data
984101030_984101032 3 Left 984101030 4:175485841-175485863 CCATTAAGTGAATCAACATATTC No data
Right 984101032 4:175485867-175485889 AAGTACTAAAAGCAAAGAAAGGG No data
984101030_984101034 9 Left 984101030 4:175485841-175485863 CCATTAAGTGAATCAACATATTC No data
Right 984101034 4:175485873-175485895 TAAAAGCAAAGAAAGGGGAAAGG No data
984101030_984101033 4 Left 984101030 4:175485841-175485863 CCATTAAGTGAATCAACATATTC No data
Right 984101033 4:175485868-175485890 AGTACTAAAAGCAAAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984101030 Original CRISPR GAATATGTTGATTCACTTAA TGG (reversed) Intergenic
No off target data available for this crispr