ID: 984103152

View in Genome Browser
Species Human (GRCh38)
Location 4:175511776-175511798
Sequence GAGGCAAATGACTCTGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984103152_984103157 12 Left 984103152 4:175511776-175511798 CCCTCTACAGAGTCATTTGCCTC No data
Right 984103157 4:175511811-175511833 AACTGACATGCCATAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984103152 Original CRISPR GAGGCAAATGACTCTGTAGA GGG (reversed) Intergenic
No off target data available for this crispr