ID: 984104270

View in Genome Browser
Species Human (GRCh38)
Location 4:175525456-175525478
Sequence ATGTCAACTCAGAAAGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984104270_984104272 7 Left 984104270 4:175525456-175525478 CCATGTTCTTTCTGAGTTGACAT No data
Right 984104272 4:175525486-175525508 AAAGTTCGAAGGTATTCTTTAGG No data
984104270_984104271 -4 Left 984104270 4:175525456-175525478 CCATGTTCTTTCTGAGTTGACAT No data
Right 984104271 4:175525475-175525497 ACATCGCATAAAAAGTTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984104270 Original CRISPR ATGTCAACTCAGAAAGAACA TGG (reversed) Intergenic
No off target data available for this crispr