ID: 984104270 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:175525456-175525478 |
| Sequence | ATGTCAACTCAGAAAGAACA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 984104270_984104272 | 7 | Left | 984104270 | 4:175525456-175525478 | CCATGTTCTTTCTGAGTTGACAT | No data | ||
| Right | 984104272 | 4:175525486-175525508 | AAAGTTCGAAGGTATTCTTTAGG | No data | ||||
| 984104270_984104271 | -4 | Left | 984104270 | 4:175525456-175525478 | CCATGTTCTTTCTGAGTTGACAT | No data | ||
| Right | 984104271 | 4:175525475-175525497 | ACATCGCATAAAAAGTTCGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 984104270 | Original CRISPR | ATGTCAACTCAGAAAGAACA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||