ID: 984112957

View in Genome Browser
Species Human (GRCh38)
Location 4:175643089-175643111
Sequence GGGAAGAATCGGTCTGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984112957_984112967 25 Left 984112957 4:175643089-175643111 CCATAATCAGACCGATTCTTCCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 984112967 4:175643137-175643159 AGCCACCAAAATCTCCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984112957 Original CRISPR GGGAAGAATCGGTCTGATTA TGG (reversed) Intronic
906891758 1:49724018-49724040 GGGTAGAATAGGAATGATTAGGG + Intronic
907877293 1:58503957-58503979 GGAAAGAATCAGTCAGATTCTGG - Intronic
916519135 1:165547537-165547559 AGGAAGAACCAGACTGATTAAGG - Intronic
917773677 1:178309591-178309613 TGGAAGAATTGGCTTGATTATGG + Intronic
918354734 1:183696850-183696872 GGCAAGAATTGGTCAGATTCTGG - Intronic
1065466536 10:26030106-26030128 GGGAAGAATGGGGCTGAGTGTGG - Intronic
1070911427 10:80122239-80122261 GGGAAGTTTTGGTCAGATTAGGG - Intergenic
1074238077 10:111606494-111606516 GGGAAGAATCTTTCTGAGAATGG + Intergenic
1077121159 11:909275-909297 GGGAAGAAACGGTTTGATGCAGG - Intronic
1079939117 11:26655936-26655958 GGCAGGAATCTGTCTCATTAAGG + Intronic
1086050790 11:82588095-82588117 GGCCAGAATCTGTCTGACTAGGG - Intergenic
1089407350 11:118209286-118209308 GGTAAGATTTGGTCTGAATAAGG - Intronic
1089432972 11:118437549-118437571 GGGGAGGATCGGTCTGCTTGGGG - Intronic
1101140304 12:101789098-101789120 GGGAAGAATCTGTCTTACTGTGG + Intronic
1105626967 13:22122022-22122044 GGGAAGATTCTCTCTGATGAAGG + Intergenic
1114490418 14:23097420-23097442 GGGAAGAATGGGTTTGAAAAAGG + Intronic
1119288745 14:73477441-73477463 GGGAAGAAAGGATGTGATTAGGG + Intergenic
1124616276 15:31244661-31244683 TGGAAGAATCGGTCTGCTCTAGG - Intergenic
1126924312 15:53565963-53565985 GAGAAGGAACGCTCTGATTAGGG + Intronic
1131396751 15:92092345-92092367 GGGAAGAAGGGCTATGATTATGG + Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1143861612 17:9895392-9895414 GGGAAGAACCTGTCTGAGAATGG + Intergenic
1146929254 17:36766139-36766161 GGTAATAACCGGTCTGATGAAGG + Intergenic
1153550862 18:6260383-6260405 GGGAAGAATCAATATCATTAAGG - Intronic
927702708 2:25277907-25277929 GGGAAAAATCGTTCTGTTTTGGG - Intronic
928586237 2:32761294-32761316 GGTAAGAAGCAGTCTGATTCTGG - Intronic
933796248 2:85922194-85922216 GGGAAAAATGGGTCTGACTCTGG - Intergenic
936712213 2:115144262-115144284 GGGAAGCATGGGTCAGAATAAGG - Intronic
945500919 2:210573719-210573741 GGGAGGTATGGGTCTGATTAAGG + Intronic
1177545557 21:22553239-22553261 GTGAGGAATGGGTCAGATTATGG + Intergenic
1182897187 22:33868629-33868651 GGGAGGAATCTGCCTGGTTAGGG - Intronic
952258399 3:31715058-31715080 GGGAAGTATGGGTCAGATTGAGG - Intronic
964838853 3:160971720-160971742 GGCAAGAATTGGTCTGTATAAGG - Intronic
966531885 3:180989965-180989987 GGAAAAAATCGGTCTGAGTAAGG - Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
988906703 5:35798055-35798077 GGGAAGAAGTGGTCTCATTCGGG - Intronic
998151445 5:139759720-139759742 CGGAAGAATTGGAGTGATTAGGG - Intergenic
998591604 5:143485054-143485076 GGCAAGAATCAGTCAGAATATGG + Intergenic
1007158038 6:39765008-39765030 GGGAAAAATCAGTTAGATTAGGG - Intergenic
1008086460 6:47250339-47250361 GGGAAGAATAGCTATGATTCTGG + Intronic
1011465074 6:87646991-87647013 GGCAAGAAGAGGTCTGATTCTGG - Intronic
1013985702 6:116190767-116190789 GGAAAGAATCGTTCTGCTGAGGG + Intronic
1016667477 6:146658677-146658699 GTGAATAATCAGTATGATTAAGG - Intronic
1020352211 7:7233377-7233399 GGGAAGAATTGGTAAGAATAAGG - Intronic
1029879567 7:103793475-103793497 GAGAAGAGTCAGTCTAATTATGG - Intronic
1031454826 7:121966032-121966054 GATAAGAAGAGGTCTGATTAGGG + Intronic
1037762950 8:21754108-21754130 GGGAAAAATAGGTCGGAGTAGGG - Intronic
1041946583 8:63450431-63450453 GGAAAGAATAGGTCTGAACATGG - Intergenic
1044533486 8:93334305-93334327 GGGAAGGAGCATTCTGATTATGG + Intergenic
1048173360 8:132129554-132129576 GGGGAGATTCGGTCCGAGTAGGG + Exonic
1055135511 9:72824567-72824589 GGGAAGAGTCGGCCTGACTTTGG - Intronic
1057081774 9:92178905-92178927 GGGAAGAAATGGTCAGATTTGGG + Intergenic
1187534425 X:20125891-20125913 GGTAAGAAGCGGTCTCTTTAGGG + Exonic
1193709873 X:84866793-84866815 GGTGAGAATCTGTCTGATTCTGG + Intergenic
1194307864 X:92270647-92270669 GGGAGGATACGGTCTCATTATGG + Intronic
1195945534 X:110206773-110206795 GGGAAGAATGGGACTGACCATGG - Intronic