ID: 984112967

View in Genome Browser
Species Human (GRCh38)
Location 4:175643137-175643159
Sequence AGCCACCAAAATCTCCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984112964_984112967 -8 Left 984112964 4:175643122-175643144 CCATCTCCTCATCCAAGCCACCA 0: 1
1: 0
2: 3
3: 49
4: 452
Right 984112967 4:175643137-175643159 AGCCACCAAAATCTCCCACTTGG No data
984112960_984112967 4 Left 984112960 4:175643110-175643132 CCACCTCCCTTGCCATCTCCTCA 0: 1
1: 0
2: 12
3: 94
4: 1064
Right 984112967 4:175643137-175643159 AGCCACCAAAATCTCCCACTTGG No data
984112959_984112967 5 Left 984112959 4:175643109-175643131 CCCACCTCCCTTGCCATCTCCTC 0: 1
1: 1
2: 11
3: 129
4: 1055
Right 984112967 4:175643137-175643159 AGCCACCAAAATCTCCCACTTGG No data
984112958_984112967 14 Left 984112958 4:175643100-175643122 CCGATTCTTCCCACCTCCCTTGC 0: 1
1: 0
2: 4
3: 62
4: 655
Right 984112967 4:175643137-175643159 AGCCACCAAAATCTCCCACTTGG No data
984112957_984112967 25 Left 984112957 4:175643089-175643111 CCATAATCAGACCGATTCTTCCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 984112967 4:175643137-175643159 AGCCACCAAAATCTCCCACTTGG No data
984112962_984112967 -2 Left 984112962 4:175643116-175643138 CCCTTGCCATCTCCTCATCCAAG 0: 1
1: 0
2: 4
3: 26
4: 308
Right 984112967 4:175643137-175643159 AGCCACCAAAATCTCCCACTTGG No data
984112963_984112967 -3 Left 984112963 4:175643117-175643139 CCTTGCCATCTCCTCATCCAAGC 0: 1
1: 0
2: 3
3: 27
4: 320
Right 984112967 4:175643137-175643159 AGCCACCAAAATCTCCCACTTGG No data
984112961_984112967 1 Left 984112961 4:175643113-175643135 CCTCCCTTGCCATCTCCTCATCC 0: 1
1: 0
2: 6
3: 80
4: 804
Right 984112967 4:175643137-175643159 AGCCACCAAAATCTCCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984112967 Original CRISPR AGCCACCAAAATCTCCCACT TGG Intronic
No off target data available for this crispr