ID: 984113848

View in Genome Browser
Species Human (GRCh38)
Location 4:175653463-175653485
Sequence GTCTGCCAAATCTTAGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984113848 Original CRISPR GTCTGCCAAATCTTAGTTTA AGG (reversed) Intronic
901571573 1:10165214-10165236 GTCTGCCCAATCTCAGTAAATGG + Intronic
904981079 1:34502318-34502340 GTCTGCCATATCTTTATTCAAGG - Intergenic
910853049 1:91667423-91667445 GTCTGTAAAATCTTACCTTATGG - Intergenic
919609656 1:199729625-199729647 GTTTGCTAACTCTTATTTTAGGG - Intergenic
920603762 1:207358400-207358422 GTATGATAAATTTTAGTTTAGGG + Intronic
923509577 1:234638623-234638645 GTTTGCCAAATCTTTGGTAATGG - Intergenic
1063361619 10:5463711-5463733 GTCTTCCACATCTTAGTAAACGG + Intergenic
1067243564 10:44517246-44517268 GGCTTTCAAATCTTATTTTATGG - Intergenic
1067968300 10:50940119-50940141 GGCTGGGAAATCTTAGTTTAAGG - Intergenic
1068675888 10:59768986-59769008 GTCTGTAAAATCTTACCTTATGG - Intergenic
1076438774 10:130464875-130464897 GTGTGGGAAATCTTTGTTTATGG - Intergenic
1083971965 11:66083524-66083546 TTCTGCCAGATCTTAGATTTGGG - Intronic
1085545329 11:77312762-77312784 GTCTGCCCACTCTTGGTATAGGG + Intergenic
1087403379 11:97696811-97696833 GTCTTCCCTATCTTAGTTAATGG + Intergenic
1090147065 11:124336543-124336565 GTGTGCCATATTTTACTTTATGG + Intergenic
1091205429 11:133817771-133817793 GTCTGCCGACTCTGGGTTTAGGG - Intergenic
1095214943 12:39537273-39537295 GCCTTCCAAATCTCAGTTGATGG + Intergenic
1095563916 12:43598234-43598256 GTTAGCCAAATAATAGTTTATGG + Intergenic
1097054885 12:56243346-56243368 GTCTGCCACATCTTTGTTGGGGG + Exonic
1097676274 12:62605200-62605222 CTGTGTCAAATCTTGGTTTATGG + Intergenic
1097785478 12:63754101-63754123 GTCTGCCAATTCTCCATTTAGGG - Intergenic
1098823221 12:75259781-75259803 ATCTGCCAAATTTAAGTGTATGG + Intergenic
1101224933 12:102678674-102678696 ATCTGCCAAATATTTTTTTAGGG - Intergenic
1105271359 13:18878319-18878341 GTCACCCAAATATTAGCTTAGGG + Intergenic
1105950097 13:25222705-25222727 GTCTGCCACATCACATTTTAAGG + Intergenic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1109703708 13:66060746-66060768 GTCTGCTAAATTATAGTTTGAGG + Intergenic
1112520793 13:100093341-100093363 TTCTTCCAAATCCTAATTTAGGG - Intronic
1112675262 13:101694068-101694090 GTCTGCCACATTTTAGTTATGGG - Intronic
1114193629 14:20459139-20459161 GTTTCCCAAATCTTAGCCTATGG + Intronic
1115845251 14:37524417-37524439 GTCTTCCAAATCTCAGTAAATGG - Intronic
1117218737 14:53579781-53579803 GTTTTCCAAATCCTAGTCTAGGG + Intergenic
1118441632 14:65817161-65817183 GTCTGCCATATAACAGTTTAGGG - Intergenic
1121476154 14:94205972-94205994 GTCTACTAAATCTTGGTTGATGG + Intronic
1122713735 14:103680426-103680448 TTCTGCCAAATTGTAGTTTTGGG + Intronic
1126222895 15:46235408-46235430 GTCACCCAAATATTAGCTTAGGG - Intergenic
1127132079 15:55877184-55877206 GTCTGCCTAATTTTAGTCCAGGG + Intronic
1127522302 15:59754865-59754887 GTCTGTCAGATCTGAGATTAGGG + Intergenic
1127923829 15:63518624-63518646 GACTGGCAAATCTAAGTATACGG - Intronic
1135849671 16:25951794-25951816 GTTTGCCAACTCTTGGTCTAGGG - Intronic
1138914274 16:61443910-61443932 GTCTGACAAATTTCAGTTAAGGG + Intergenic
1144080994 17:11763673-11763695 GTCTTCCAAATCTTTGCTAAAGG - Intronic
1151558513 17:74859207-74859229 GTTTGTCAAACATTAGTTTAAGG - Intronic
1153109894 18:1573673-1573695 TTCTGCCAAATCTTGATTTTTGG + Intergenic
1154331662 18:13434632-13434654 GTCTGTCAAAGTGTAGTTTAGGG + Intronic
1155785608 18:29896316-29896338 GTCTGCCAGTACTTGGTTTATGG - Intergenic
1156393109 18:36671565-36671587 GTGTGCCAACTTTTACTTTATGG + Intronic
1158626595 18:59077110-59077132 GTCTTACAAATCTCAATTTAGGG - Intergenic
925250130 2:2425977-2425999 GTTTGGCAAATCTTATTTTGAGG - Intergenic
925738908 2:6987801-6987823 TCCTGCAAAATCTTAATTTAGGG + Intronic
925976081 2:9142995-9143017 GTCTGCGAACTCTGAGTTTGAGG - Intergenic
929413719 2:41726137-41726159 TTCTGCCAAATCATAGTAAAAGG + Intergenic
930859128 2:56051657-56051679 TTCTCCCAAATCTTAATTCATGG - Intergenic
931984379 2:67727486-67727508 GCCTGCGAAATCTTAGATTTGGG - Intergenic
935970495 2:108526477-108526499 GTCTATAAAATCTTACTTTATGG + Intergenic
936419683 2:112351431-112351453 GTCTATAAAATCTTACTTTATGG - Intergenic
940161619 2:150719886-150719908 GCTTGCCAAATCCTAGTGTAGGG - Intergenic
940888323 2:159010642-159010664 ATCTGCCAAATCCTATTTCAAGG + Intronic
942302567 2:174575659-174575681 ATTTGCCAAATCTTAGGATACGG - Intronic
942852391 2:180504299-180504321 GTCTTCCCAATCTTAGTTTCTGG - Intergenic
943230769 2:185248104-185248126 GTCAGACAAATCTTTGTTCAAGG + Intergenic
944141875 2:196465569-196465591 GTAAGCCTAATCTTACTTTAGGG + Intronic
944670315 2:201988983-201989005 GTCTTCCAAAGCTTAGAATAAGG - Intergenic
945041202 2:205745180-205745202 GTTTCCCAAACCTTTGTTTAGGG - Intronic
945781806 2:214184067-214184089 GTTTGCCAACTCTTTGTTAATGG - Intronic
946531535 2:220576050-220576072 GCCTGCCAAGTTTTGGTTTATGG + Intergenic
947265657 2:228277262-228277284 GTCTGCCAGATTTTGGTATAAGG - Intergenic
947525333 2:230873837-230873859 TTCTGCCAGATCTGAGTTTCTGG - Intronic
1169940029 20:10926906-10926928 ATCTGCCCAATGTCAGTTTAAGG + Intergenic
1171395922 20:24833045-24833067 GGCTCCCAAATCTTAGGTTCTGG - Intergenic
1174098011 20:48104893-48104915 GTCTGCCACACCTTTCTTTAAGG + Intergenic
949503948 3:4709068-4709090 CTCTGGCAAATCTTTGTCTACGG - Intronic
960727007 3:120680744-120680766 GTCAGCCAAATTTGAGTTGATGG - Intronic
964583570 3:158269324-158269346 GTAAGCCTAATGTTAGTTTATGG + Intronic
964893210 3:161561454-161561476 GTCTCCCTTATGTTAGTTTATGG + Intergenic
965422528 3:168479819-168479841 GCCTACAAAATCGTAGTTTAAGG - Intergenic
966587050 3:181637998-181638020 GTTTGCCAACTCTTACTGTAAGG - Intergenic
966690712 3:182738605-182738627 GTTTGCCAAATATTTGTTAATGG - Intergenic
969162698 4:5275315-5275337 GTTTGGCAGATCTTATTTTATGG + Intronic
970777515 4:19693780-19693802 GTCTGACAAATCTTTATTTAAGG - Intergenic
971456725 4:26852150-26852172 GTCTTCCACATCTTGGTTGATGG + Intergenic
972755932 4:42046055-42046077 TTCTGCCAATACCTAGTTTAAGG - Intronic
975429726 4:74274618-74274640 ATATGACAAATCTTAGTTTATGG + Intronic
978950055 4:114547267-114547289 TTTTGCCAATTCTTAGTTCAAGG + Intergenic
979968095 4:127100670-127100692 TTTTTTCAAATCTTAGTTTATGG + Intergenic
982046058 4:151447257-151447279 GTCTTCCAAATGTTAATTCAAGG + Intronic
982362523 4:154535625-154535647 GTCTGACAAATCTTGATTAATGG + Exonic
984113848 4:175653463-175653485 GTCTGCCAAATCTTAGTTTAAGG - Intronic
985829629 5:2218967-2218989 TTCTGGCAAATTTGAGTTTAGGG + Intergenic
986576563 5:9219416-9219438 GTCTCCCAAAACTTATGTTAAGG + Intronic
989610554 5:43286618-43286640 GTCAGCCAACTGTCAGTTTAAGG - Intergenic
992845974 5:80748045-80748067 GACTGCCAAAGGTTAGTTTAGGG + Intronic
992853755 5:80838978-80839000 GTTTGCAAATTCTTATTTTAGGG - Intronic
994648695 5:102500355-102500377 GTTTACCAGATCTTTGTTTAAGG + Intergenic
995418218 5:111933964-111933986 TTATTCCAAAGCTTAGTTTAGGG + Intronic
996758396 5:126960203-126960225 TTATGCCAACTTTTAGTTTATGG - Intronic
998983425 5:147729166-147729188 GTCAGCCAACTCTTAATTCAGGG - Intronic
1003780324 6:9417112-9417134 TTCTGCTAATCCTTAGTTTAGGG - Intergenic
1004407787 6:15350708-15350730 CAATGCCAAATCATAGTTTAAGG + Intronic
1008240448 6:49103382-49103404 GTCTTTCAAATGTTAGATTAGGG + Intergenic
1008409844 6:51163727-51163749 GTCTGGCAAATAATAGTTTAGGG + Intergenic
1009409283 6:63346880-63346902 GTCTCCCAATTCATTGTTTAGGG - Intergenic
1009792043 6:68416123-68416145 GTCTGTCACATCTGAGTTTGTGG - Intergenic
1012241071 6:96872929-96872951 CTCTGCCAAATGTTACTTCATGG - Intergenic
1013815649 6:114094416-114094438 CTCTGAGAAATCTCAGTTTATGG - Intronic
1015751381 6:136563142-136563164 GTCTTCCAAAGCTTAGCTTCTGG - Intronic
1022656511 7:32324135-32324157 TTCTGCTAAAACTTTGTTTATGG - Intergenic
1030447970 7:109671055-109671077 GTCTGCCATATATGAGTTGAAGG - Intergenic
1032886387 7:136143865-136143887 GCCTTCCCAATCTTAGTTGATGG + Intergenic
1033709419 7:143925668-143925690 GTCTCCTAAATCTTATTCTAGGG + Intergenic
1033894352 7:146053314-146053336 GCCTGCCAAATCTTACCTTGGGG - Intergenic
1038132240 8:24745382-24745404 GTCTGGCAAATTGTAGTTAATGG - Intergenic
1039205002 8:35142409-35142431 CTCTGTCAAAACTGAGTTTAGGG - Intergenic
1041337680 8:56806130-56806152 GACTGCCAAGTCTTTGTTTGTGG - Intergenic
1042365485 8:67931639-67931661 GTCTTTGAAATTTTAGTTTAAGG - Intergenic
1043230454 8:77793916-77793938 TTCTACCAATTCCTAGTTTAGGG + Intergenic
1043790506 8:84461530-84461552 GTCTGCAAAATCTTGTTTTCTGG + Intronic
1045025539 8:98083231-98083253 GTCTGCCAAATTATATTTTCTGG - Intronic
1046647271 8:116799890-116799912 GTCTTCCAAATCTAAATCTAGGG + Intronic
1055927894 9:81529532-81529554 GTCTTCCAAATATTAGCTGAGGG - Intergenic
1060635659 9:125198011-125198033 GTCTGCCAAAGAGAAGTTTAGGG - Intergenic
1062199470 9:135294157-135294179 GCCTGCCAAATCTTACATTATGG + Intergenic
1187110406 X:16292843-16292865 GTCTTCCTCATCTTAGTTAATGG - Intergenic
1193049440 X:77084875-77084897 GCCTGCCAAGTCTTACTTTGTGG + Intergenic
1193655251 X:84189593-84189615 TTCAGCCAAATATGAGTTTATGG - Intergenic
1199176721 X:144797314-144797336 GTATGCCAAATATTTATTTATGG + Intergenic
1199940049 X:152616374-152616396 CTCTGCCAAATATCAGTTTAGGG - Intergenic